Jack Russell Terrier Club of America Preserve, Protect and Work the Jack Russell Terrier

Jack Russell Picture Caption Contest Results

The following are the results from our Picture Caption Contests for 2007.

Results from Contest # 252 [December 30, 2007 - 178 entries]


Contest #252 1st place PUPsicle. [votes: 50]  Pat
2nd place You have a little something on your chin. [votes: 44]  Chris
3rd place 5...4...3...2...1... Happy New Year!! (smooch) [votes: 33]  Greggo
 
Honorable Mentions
  • Takes a lickin', keeps on tickin'. [votes: 26]
  • I hate spit baths. [votes: 21]
  • No tongues! NOOOOO tongues!! [votes: 14]
  • Don't worry...I'm a trained professional. [votes: 12]
  • One down, ten to go. [votes: 11]
  • Who doesn't love the new year baby?! [votes: 11]
  • Do you think this will get us on the internet? [votes: 11]
  • Spot-checking. [votes: 10]
  • I love you man! [votes: 9]
  • Jack be nimble, jack be lick! [votes: 9]
  • Curbside tongue service. [votes: 6]
  • I don't know. Ask your mom. [votes: 3]
  • I surrender!!!! [votes: 2]

Results from Contest # 251 [December 23, 2007 - 108 entries]


Contest #251 1st place You vill NOT take zees tennis ball! Nein! Nein! [votes: 45]  Kirie W
2nd place My human has too much time on his hands. [votes: 32]  Pat
3rd place It's like eating a squirrel. Once you get the fur off, it's nice and chewy. [votes: 29]  cred
 
Honorable Mentions
  • The hat gets returned, but I keep the ball! [votes: 21]
  • Jack In The Hat. [votes: 20]
  • My hat's too big and my mouth's too small! [votes: 20]
  • Yes, I Drink Alone! [votes: 13]
  • Couches, tennis balls and Harley Davidson hats, these are a few of my favorite things. [votes: 13]
  • Are you sure this is gonna impress the judges???? [votes: 11]
  • Why do people think this is so funny? [votes: 9]
  • Open mouth, insert ball. [votes: 9]
  • Has the ball dropped yet? [votes: 9]
  • Newest member of the "Jacks of Columbus". [votes: 7]
  • Back away, there is nothing to see here. [votes: 6]
  • I wear this so they can spot me in the snow. [votes: 4]

Results from Contest # 250 [December 16, 2007 - 190 entries]


Contest #250 1st place This means she gave the baby my chew toy again. I hate when she loses her glasses! [votes: 66]  cred
2nd place If you think this is gonna shut me up you are so wrong. [votes: 43]  Bevansley
3rd place Yeah I took it from the kid and not giving it back. [votes: 27]  anon
 
Honorable Mentions
  • These thing'll never replace a good crunchy squirrel. [votes: 15]
  • Silence of the Jacks. [votes: 13]
  • And poor Jack needed therapy the rest of his life. [votes: 12]
  • Dude, the cat is laughing at me. [votes: 12]
  • Yelp control. [votes: 11]
  • Got binky? [votes: 8]
  • What she doesn't know, is that I just destroyed her shoe. [votes: 7]
  • This is no way to break my chipmunk habit. [votes: 7]
  • This dingo ate your baby! [votes: 7]
  • Please don't take my binnky. [votes: 5]
  • I better knock it off. I'm gonna have an overbite!!! [votes: 5]
  • Jack love his binky. [votes: 3]
  • Preparing for the baby. [votes: 2]
  • Please save me! Please! [votes: 2]
  • Nobody puts baby in the corner! [votes: 2]
  • 21 Seconds to a Pacified Dog. [votes: 2]

Results from Contest # 249 [December 9, 2007 - 266 entries]


Contest #249 1st place Santa's little YELPER. [votes: 48]  Pat
2nd place Reason 101 why animals attack during the holidays. [votes: 34]  Mandy
3rd place Clearly, Jack has been spending too much time at elfyourself.com. [votes: 25]  vicki
 
Honorable Mentions
  • This is as jolly as I'm gonna get! [votes: 23]
  • HOHOHO! I left a nice gift under the tree. [votes: 21]
  • I ate the naughty list, because my name was on it. [votes: 19]
  • Yeah, I ate an elf...so what? [votes: 18]
  • This is elfin embarrassing. [votes: 17]
  • I'm only doing this for the presents! [votes: 16]
  • Hand over the cookies or the Fat man gets it. [votes: 12]
  • All I want for christmas is for it to be OVER... [votes: 12]
  • I'm one of Oprah's favorite things! [votes: 7]
  • OH YEAH,... I'M KEEPING A LIST... [votes: 7]
  • I make this look cool. [votes: 6]
  • Elves taste good with ketchup. [votes: 6]
  • I've been a baad elf! [votes: 6]
  • Jack makes an elf of himself. [votes: 6]
  • Hermey wants to be a dentist... [votes: 6]
  • I have the sense people are staring at me this moment... [votes: 4]
  • Pssst....I've got the keys to the sleigh tonight. [votes: 3]
  • All I want for Chistmas is a cat in my teeth! [votes: 3]
  • Ho, Ho, Hole!!!! [votes: 2]
  • Don't mess with the elf! [votes: 1]
  • How about a little elf magic? [votes: 1]

Results from Contest # 248 [December 2, 2007 - 223 entries]


Contest #248 1st place I didn't do it! It was like that when I got here! [votes: 68]  C
2nd place This chicken will not be crossing the road. [votes: 32]  Debbie W
3rd place I killed it...You cook it. [votes: 28]  Bevansley
 
Honorable Mentions
  • What am I supposed to do with this? [votes: 23]
  • Mom, look what the cat dragged in! [votes: 15]
  • We'll make the breast of it... [votes: 15]
  • Okay, who's next? [votes: 15]
  • Jack Be Nimble Jack Be Quick, Jack Didn't Know What To Do With The Chick. [votes: 14]
  • May I ask what the chicken did? [votes: 14]
  • Another one bites the dust. [votes: 11]
  • That's mine, don't touch it. [votes: 9]
  • Me thinks me killed the chicken, better not look. [votes: 9]
  • Help, the chick has fallen and can't get up!! [votes: 8]
  • Another boring banquet rubber chicken dinner! [votes: 8]
  • Excuse me...I think the chicken has gone bad... [votes: 7]
  • Waiter! Where's my bowl of Chardonnay? [votes: 5]
  • Allow me to say a few words about the chicken. [votes: 5]
  • The new BARF diet. [votes: 4]
  • Chicken tonight! [votes: 1]
  • Chicken......just the way I like it !! [votes: 1]
  • My first go-to-ground win. [votes: 1]

Results from Contest # 247 [November 25, 2007 - 262 entries]


Contest #247 1st place MOM!!!.... HE'S TOUCHING MEEEE!!!! [votes: 77]  Sindy
2nd place I hope this isn't your favorite cat. [votes: 30]  Doug
3rd place oh darn, witnesses... [votes: 25]  jimmy
 
Honorable Mentions
  • That's it - blind me with the flash - just when I corner the cat? [votes: 20]
  • OK, this is the last time I answer a personal ad! [votes: 20]
  • Go to a happy place! Go to a happy place! Go to a happy place!! [votes: 18]
  • Oh man....this wasn't supposed to be on camera! [votes: 16]
  • I should have known, she's going right for the jewelry. [votes: 15]
  • I like 'em to think they have a chance before I eat 'em. [votes: 15]
  • Somebody please adopt me...NOW! [votes: 14]
  • What did I do? [votes: 12]
  • Jack knew right then that this relationship would never work out. [votes: 11]
  • It's going to be one of those days. [votes: 10]
  • What do you mean your mother is coming for the weekend? [votes: 8]
  • Playing with my food. [votes: 7]
  • When did my life take such a terrible turn? [votes: 6]
  • Tabby was never seen again. [votes: 6]
  • Did I thank you for my new Squeaky toy? [votes: 6]
  • When good cats go bad. [votes: 5]
  • Got Cat???? I do!!! [votes: 4]

Results from Contest # 246 [November 18, 2007 - 214 entries]


Contest #246 1st place It's going to take a while to get the squeaker out of this one! [votes: 45]  Vickie
2nd place Jack thought he better be nice to the new cat. [votes: 37]  vickie
3rd place Keep smiling, they're almost gone. [votes: 31]  Sarah M
 
Honorable Mentions
  • Wait for it...wait for it... [votes: 21]
  • Jack Spratt could eat no fat; his wife could eat no lean. [votes: 21]
  • Yeah I know Dad, she's not from around here. [votes: 18]
  • I jump around constantly, what is your superpower? [votes: 17]
  • I've got you babe. [votes: 16]
  • One good reason to spay and neuter! [votes: 15]
  • I hate when the frisbee goes over the fence. [votes: 14]
  • When Harry met Not-So-Harry. [votes: 13]
  • The boss is a need'n the 15 bones you owe him. [votes: 12]
  • Your haircut looks really nice, hon. [votes: 10]
  • Jack now regrets being the wingman. [votes: 7]
  • I've heard of bed head, but this must be kennel head! [votes: 7]
  • Give me your coat. [votes: 5]
  • Look what I dug up. [votes: 5]
  • Eskimo Jack visiting the lower 48. [votes: 4]
  • Would you look at that.. [votes: 4]

Results from Contest # 245 [November 11, 2007 - 267 entries]


Contest #245 1st place You're not as big as I think I am. [votes: 48]  parker
2nd place Fox Hunt on Saturday? Count me in! [votes: 38]  Divot
3rd place You gotta win tomorrow, I bet all my biscuits. [votes: 34]  luanne
 
Honorable Mentions
  • "... and then I struck this pose, and won the show." [votes: 24]
  • I'll get the gate, you take the blame, got it? Good. [votes: 21]
  • Listen horse, big is all in the attitude! [votes: 21]
  • If you are 50% white and can stand like this, I can get you in. [votes: 16]
  • I'm Wilber, what your name? [votes: 15]
  • The Horse Whisperer. [votes: 15]
  • I thought I was the long legged, 50% white, smooth coat. [votes: 14]
  • ... and there was this one time at band camp. [votes: 14]
  • "Are you my mother?" "Neigh." [votes: 10]
  • That's a mighty fine crate you have! [votes: 9]
  • Lookin' for love in all the wrong places. [votes: 9]
  • You must be an over! [votes: 7]
  • I'm going to give you one more chance to tell the truth. Then it's going to get ugly. [votes: 7]
  • One neighsayer didn't know Jack! [votes: 7]
  • Howdy partner! [votes: 6]
  • You had me at hello! [votes: 4]
  • Yeah, I'm betting on you in the Derby. [votes: 3]
  • How's the weather up there? [votes: 3]
  • Are you thinking what I'm thinking? [votes: 1]

Results from Contest # 244 [November 4, 2007 - 203 entries]


Contest #244 1st place Jacky plans his getaway from obedience class.  Becky
2nd place Tour De Jack. [votes: 37]  Gerry Hazelton
3rd place This agility training is just getting out of hand! [votes: 35]  Matt Haring
 
Honorable Mentions
  • I never thought I'd be thanking God for being NEUTERED! [votes: 28]
  • Must... catch... mailman! [votes: 25]
  • Who put this junk on my beautiful dirt?? [votes: 20]
  • This doesn't feel right. And I look stupid. [votes: 19]
  • Too bad I chewed all the rubber of the tires, this would have been fun to ride. [votes: 15]
  • THE COLLIES Are COMING... THE COLLIES ARE COMING ... [votes: 15]
  • Whadaya mean it's a lawn ornament? [votes: 14]
  • Easy Rider. [votes: 14]
  • Let them heel -- I'm gonna WHEEL! [votes: 13]
  • Two tires, and a splash of gas - Daytona "2008" here I come!!! [votes: 11]
  • ooouch!! Aren't these things suppose to have seats?? [votes: 10]
  • What do you mean they're still not looking? [votes: 10]
  • Jack realized in horror that his bike may have been a rip off! [votes: 10]
  • Gotta get away from all these shelties. [votes: 9]
  • WHAT! no horn on it? [votes: 6]
  • If I wanted to go in circles, I would have just chased my tail. [votes: 6]
  • I run faster than I pedal... [votes: 5]
  • Hey, this isn't my bike, mine moves. [votes: 5]
  • Wow! I'm jealous it's 100% white. [votes: 4]
  • Jack be nimble. [votes: 3]
  • oops - I think I've split my difference! [votes: 3]
  • Wheel meet again. [votes: 2]
  • Jack's stationary bike. [votes: 1]

Results from Contest # 243 [October 28, 2007 - 267 entries]


Contest #243 1st place If you think I am dirty, you should see the cat I'm standing on. [votes: 77]  Bill He
2nd place The next thing you know 'ol Jack's a millionaire... [votes: 56]  Clampett
3rd place I think I found your problem, lady. [votes: 50]  Steve T
 
Honorable Mentions
  • I guess sleeping in the bed is out of the question. [votes: 31]
  • What do you mean I need a bath? [votes: 29]
  • Life is good. [votes: 21]
  • Come on in; the water's fine! [votes: 16]
  • Muddy Buddy. [votes: 16]
  • Heaven!! [votes: 15]
  • It puts the lotion on the skin! Or it gets the hose again! [votes: 15]
  • Got Mud! [votes: 15]
  • Jack fell down a well....but saw no reason to get out! [votes: 9]
  • I think I went too far to ground. [votes: 8]
  • I'm still 51% white. [votes: 7]
  • Sometimes it's just too challenging to clean up after your dog. [votes: 6]
  • I'm 17% white! [votes: 5]
  • Going to Ground should be cancelled during the rainy season! [votes: 4]
  • I hope this is mud! [votes: 3]
  • I'm meeelting!! I'm meeelting!! [votes: 2]
  • I'm dirty and plan to stay this way. [votes: 2]

Results from Contest # 242 [October 14, 2007 - 337 entries]


Contest #242 1st place I'm here to spay and neuter the cats... [votes: 38]  Beverly
2nd place McDreamy's got nuthin' on me! [votes: 35]  Divot
3rd place I have a son, and another son, and another son, and a daughter, and another daughter. [votes: 30]  Vic
 
Honorable Mentions
  • I'm gonna love performing THIS cat scan!!!! [votes: 29]
  • Jack's Anatomy. [votes: 20]
  • I delivered 8 litters today... [votes: 19]
  • First lick the wound clean, then roll in the dirt. [votes: 19]
  • You won't think this is so funny when you see what I did to your shoes... [votes: 19]
  • Mr. Vet...the Jack will see you now...hehehe. [votes: 17]
  • Lunch Lady Jack. [votes: 15]
  • I need a toy, stat! [votes: 12]
  • Smooth operator. [votes: 11]
  • Jack prepares for his second job a Wal-Mart deli attendant. [votes: 10]
  • Just one of the HMO doctors. [votes: 10]
  • Wow...what happened last night? [votes: 7]
  • Jack had to hide the fact that he was a rough coat, but only around the ears. [votes: 6]
  • Beauty school drop out... go back to high school... [votes: 5]
  • My turn!!! Where's that thermometer? [votes: 5]
  • But you don't understand; I like getting my hair wet! [votes: 3]
  • Don't tell the judge that I had my ears done. [votes: 2]

Results from Contest # 241 [October 7, 2007 - 263 entries]


Contest #241 1st place And the ball went in here? ... and it's orange? [votes: 96]  Bobby and DJ
2nd place Jack-o-lanterns. [votes: 68]  raegan
3rd place Please don't lift Jack's by their stem. [votes: 60]  Jolee
 
Honorable Mentions
  • I swear, he's in here somewhere! He had a big, toothy grin, and yellow shining eyes. [votes: 41]
  • A couple of jacks out of their gourds... [votes: 36]
  • Did you see something move? I saw something move!! [votes: 33]
  • What's a pumpkin? I don't know, but there's got to be one in here somewhere. [votes: 29]
  • The best ones are always at the bottom. [votes: 25]
  • Seriously dude, it was smiling at me! [votes: 25]
  • I'm tellin' ya Charley, one of 'em has to have a face. [votes: 22]
  • ... and that's mine, and that's mine, and that's mine. [votes: 22]
  • The Headless Jacks ride again every Halloween! [votes: 22]
  • Pumpkin, Pumpkin, Pumpkin, Pumpkin, Pumpkin, Gourd, no wait! Pumpkin! [votes: 19]
  • Dig man Dig!!! [votes: 18]
  • Jack and Jill realized with horror that they may just be in the wrong nursery rhyme. [votes: 15]
  • Dumpster Diving! [votes: 11]
  • The end of the pumpkin patch. [votes: 8]
  • Just can't wait for pumpkin pie! [votes: 3]
  • Sometimes ya gotta take the rough with the smooth during the harvest. [votes: 2]
  • Pumpkin head, pumpkin head! [votes: 1]

Results from Contest # 240 [September 30, 2007 - 256 entries]


Contest #240 1st place Slumber Jack. [votes: 78]  Jolee
2nd place Don't wake me unless you have a confirmed squirrel sighting. [votes: 50]  Anne Wetzork
3rd place Sleeping like a log. [votes: 38]  Regie Simmons
 
Honorable Mentions
  • Lumber Jack. [votes: 32]
  • Ssshhh! Be wery, wery quiet...we're hunting wabbits! [votes: 23]
  • Bark-o-lounger [votes: 21]
  • Jack rested contently, knowing the squirrels had nowhere else to hide. [votes: 20]
  • Wanna know my sleep number? [votes: 18]
  • I get more work done by 5am then most dogs get done all day. [votes: 18]
  • I'm a lumber Jack and I'm OK... [votes: 17]
  • This is not my definition of a "working" terrier! [votes: 15]
  • I'm just resting my eyes. [votes: 14]
  • Just another bump on a log. [votes: 11]
  • Power Nap. [votes: 8]
  • Jack was kicked out of drama class for being too wooden. [votes: 6]
  • Jack laid there with a splitting headache. [votes: 6]
  • My bark is bigger than my bite. [votes: 4]
  • All Work And No Play. [votes: 2]

Results from Contest # 239 [September 23, 2007 - 205 entries]


Contest #239 1st place Another ugly shirt gift from Grandma. [votes: 29]  Belle
2nd place - tie Does this shirt go with my tongue? [votes: 28]  hmpstd
2nd place - tie Clive often wondered why he was labeled a "nerd". [votes: 28]  Scott Beasley
 
Honorable Mentions
  • Watch out I can't control my licker! [votes: 21]
  • Eat your heart out Gene. [votes: 20]
  • Jack on Casual Friday. [votes: 18]
  • They call me Sponge Bob No Pants! [votes: 18]
  • Prep school dropout. [votes: 17]
  • Any trace of the cat on here? [votes: 16]
  • I make this shirt look good! [votes: 16]
  • Look me in the eye, no, the other eye. Oh forget it! Just look at my tongue! [votes: 15]
  • Why would you do this to someone you love?! [votes: 14]
  • This is what I think of red trim on a light blue shirt. [votes: 11]
  • If I could just.. get.. the top button... [votes: 11]
  • Stamp licking Jack. [votes: 10]
  • Ahhh, I'll never get a date with grandpa dressing me! [votes: 10]
  • OK, I'll wear your shirt if you will let me pee on your leg. [votes: 6]
  • Poor Jack. He was always picked last for GTG. [votes: 5]
  • I only LOOK innocent. [votes: 4]

Results from Contest # 238 [September 16, 2007 - 253 entries]


Contest #238 1st place What happens at the boarding kennel, stays at the boarding kennel. [votes: 86]  Linda
2nd place If lovin' you is wrong, I don't wanna be right. [votes: 47]  scout
3rd place Little ditty bout Jack and Diane. [votes: 25]  Tony
 
Honorable Mentions
  • Cat Log Day 3: New cell mate still jumpy. Can't shake feeling she's planning on eating me. [votes: 23]
  • Reminder to self: NEVER listen to the cat! [votes: 22]
  • Misery loves company. [votes: 15]
  • It's bad enough to be arrested, but to put in with a cat... [votes: 15]
  • Prison Buddy. [votes: 10]
  • Prisoners of Love. [votes: 10]
  • He ain't heavy...he's my brother. [votes: 10]
  • Well at least Jack got to take his pillow with him to Jail. [votes: 9]
  • Behind enemy lines. [votes: 7]
  • I've got friends in low places. [votes: 7]
  • Opposites attract. [votes: 7]
  • Cat nip [votes: 5]
  • Jack's first chew toy that made real sense! [votes: 5]
  • Desperate times call for desperate measures. [votes: 4]
  • Some Things Happen Once In A Lifetime... [votes: 4]
  • Only the Lonely [votes: 4]
  • Where is that bail Bondsman? [votes: 4]
  • Cats got your tongue? [votes: 4]
  • Midnight Snack. [votes: 3]
  • If you can't do the time, don't do the crime. [votes: 3]
  • Here today....gone tomorow! [votes: 3]
  • One of these had better be stuffed! [votes: 2]

Results from Contest # 237 [September 9, 2007 - 201 entries]


Contest #237 1st place Now thats marking your territory!!! [votes: 70]  David Hale
2nd place Distance was only one of the reasons the entire pack looked up to spike. [votes: 40]  Jim P
3rd place Jacks compete for accuracy, Great Danes compete for distance.  Vicki
 
Honorable Mentions
  • Wow, Sparky had to go REAL bad! [votes: 22]
  • Uh, that's not a fountain bro. [votes: 22]
  • The tree! The tree! You're suppose to hit the tree! [votes: 22]
  • OK, I'm impressed. [votes: 17]
  • You go first....No you go first... [votes: 16]
  • That better be hose water! [votes: 15]
  • Hey dont lick that..I don't think it's a fountain. [votes: 10]
  • Cool trick, Bobby, but you ain't gettin' us to chase it! [votes: 6]
  • Guys remember never cross the stream or else... [votes: 6]
  • I wanna know where that water is coming from. [votes: 6]
  • Are WEEEEE having fun yet? [votes: 4]
  • Suddenly fire hydrants didn't seem so important now... [votes: 3]
  • Where's the lifeguard? [votes: 3]
  • Have no fear the pool cleaners are here! [votes: 3]
  • He missed again! [votes: 2]

Results from Contest # 236 [September 2, 2007 - 357 entries]


Contest #236 1st place Russell Rescue [votes: 67]  Cheryl
2nd place COWABUNGA DUDE!! [votes: 42]  Sindy
3rd place I'm.. too sexy for my vest.. too sexy for my board. [votes: 28]  Thom
 
Honorable Mentions
  • wait for it.......wait for it...... [votes: 26]
  • Oh No, that's not the "Jaws" music, is it? [votes: 24]
  • Oooooh....Everbody's gone surfin... JRTCA! [votes: 23]
  • Bark Watch. [votes: 20]
  • 2007 JRTCA National Aquatic agility trials [votes: 18]
  • Here I come to save the day!!!! [votes: 18]
  • And we will have fun, fun ,fun, till our daddy takes our steak bones away! [votes: 13]
  • This thong is killing me! [votes: 12]
  • My mom dressed me like this. [votes: 11]
  • Watch me "Hang eight". [votes: 11]
  • A Three Hour Tour, A Three Hour Tour. [votes: 10]
  • I make these look good. [votes: 7]
  • I'm so cool, I can't even take it. [votes: 7]
  • Jack's endless summer. [votes: 7]
  • Waitin' for the big one! [votes: 5]
  • Jack be nimble, Jack be Slick, Jack hurry to my boat real quick! [votes: 5]
  • Jack couldn't bring himself to be saved by a CAT-amaran! [votes: 4]
  • Next time, with truth or dare, I'll choose truth!!! [votes: 4]
  • OK, you win.......come back! [votes: 4]
  • California dreamin. [votes: 3]

Results from Contest # 235 [August 26, 2007 - 216 entries]


Contest #235 1st place When did these chew bones come with a hairball attached? [votes: 48]  EBT
2nd place I might look small, but it's MINE. [votes: 44]  kd
3rd place Jack the Gripper [votes: 42]  Pat
 
Honorable Mentions
  • Your huge paws are no match for my attitude...I suggest you let go!! [votes: 36]
  • Chewin' with the BIG dogs! [votes: 34]
  • I promise I'll bring it right back. [votes: 22]
  • I got my money on the Jack... [votes: 19]
  • Size doesn't matter! [votes: 18]
  • Brains vs. Brawn. [votes: 18]
  • No retreat....no surrender!! [votes: 17]
  • Let me help you chew on that. [votes: 16]
  • Now If the dog on the Right was bigger, It'd be a Fair fight! [votes: 15]
  • bone heads... [votes: 14]
  • The mailman didn't have a chance. [votes: 14]
  • Beauty and the Beast. [votes: 12]
  • I see you're on your last tooth, this will be easy... [votes: 12]
  • Courage is... [votes: 10]
  • ShareHOLDER [votes: 8]
  • No Fear... [votes: 8]
  • And I have the results of the paternity tests...right here! [votes: 8]
  • I love flirting with danger. [votes: 7]
  • Look who Jack brought home! [votes: 5]
  • Let's meet in the middle! [votes: 4]

Results from Contest # 234 [August 19, 2007 - 339 entries]


Contest #234 I .... want .... OUTTTTTTTTTTTT!!! [votes: 77]  Julz
OOOOAKlahoma where the wind ... [votes: 53]  Nora
Brother for sale, cheap! [votes: 35]  jack's girls
 
Honorable Mentions
  • That's IT!! One more Jack in the Box comment and I'm sicking my little brothers on your ankles! [votes: 34]
  • HEY Meester, want to buy my seester? [votes: 29]
  • I'm obnoxious, pick me! [votes: 29]
  • If someone doesn't play with me soon, I'm gonna scream even louder!!! [votes: 21]
  • See, still have all my puppy teeth; I am completely harmless to your furniture. [votes: 21]
  • LEG CRAMP!!!!!!!!!!!!!! [votes: 21]
  • Hey Ump, you stink! [votes: 20]
  • Shout! Shout! Let us all out! [votes: 12]
  • I want fries with that, please! [votes: 9]
  • And stay out!!! [votes: 8]
  • I always get stuck with singing the lead in all our road shows. [votes: 6]
  • help !! i'm trapped with nonconforming jacks !! [votes: 3]
  • Time to make the biscuits! [votes: 2]
  • Hey does anyone have any a mint??? [votes: 1]

Results from Contest # 233 [August 12, 2007 - 189 entries]


Contest #233 OK, the leak is at the PVC coupling. Hand me a new one, will ya? [votes: 36]  Sniggy
Yikes, my roots are showing! [votes: 31]  Vessey
I love the smell of gopher in the morning... [votes: 31]  Brenda
 
Honorable Mentions
  • I don't think I'm in Kansas anymore. [votes: 28]
  • This is the BEST place I've ever made! [votes: 23]
  • Where am I and where are my pants? [votes: 23]
  • MMMMM HOBBIT.......... TASTY! [votes: 22]
  • Dirty dog done dirt cheap! [votes: 21]
  • This hunting stuff makes you very tired. [votes: 18]
  • I'm hiding from my mother-in-law. [votes: 18]
  • Power Nap. [votes: 13]
  • Am I there yet? [votes: 12]
  • Last night I slept like a log....and woke up IN one! [votes: 12]
  • I knew I shouldn't have eaten that last donut. [votes: 11]
  • I can't believe I ate the whole thing. [votes: 9]
  • Was that fun, or what! [votes: 9]
  • Here kitty, kitty. [votes: 8]
  • Sweet dreams are made of this... [votes: 7]
  • HELP! I've fallen and I can't get up. [votes: 4]
  • Luxurious Clay Bath. [votes: 3]
  • Home dirty home. [votes: 3]

Results from Contest # 232 [August 5, 2007 - 278 entries]


Contest #232 Say hello to my little friend... [votes: 45]  Bailey
I asked for a brother and this is what I got. [votes: 30]  Kat
This is my brother, from another mother. [votes: 27]  George
 
Honorable Mentions
  • I dare you to take it. [votes: 26]
  • Okay, I took the cute picture, can I eat it now? [votes: 25]
  • Jack liked to take a picture of his victims... [votes: 19]
  • Please play with us. [votes: 17]
  • My friend Sammy I want a cookie. Oh, and he said I could have his. [votes: 17]
  • Pete and Repeat. [votes: 16]
  • Ever notice how toys (like owners) eventually resemble their dogs? [votes: 14]
  • Back away slowly and no one will get hurt. [votes: 10]
  • Me and my shadow. [votes: 8]
  • He ain't heavy... he's my brother. [votes: 7]
  • A latchkey dog's best friend. [votes: 6]
  • If I hold still enough, the cat will never notice until it's too late! [votes: 6]
  • We have only been together for 3 days and the thrill is gone! [votes: 6]
  • And Mom said I was the only child! [votes: 5]
  • You won't be smiling when I'm done with you! [votes: 5]
  • The cat sent my brother to a taxidermist... [votes: 5]
  • Good cop, bad cop. [votes: 3]
  • Like father like son. [votes: 2]
  • Methinks he doth smile too much !!!! [votes: 2]

Results from Contest # 231 [July 29, 2007 - 288 entries]


Contest #231 Beware: puppy smarter than owner. [votes: 56]  Vickie
Proof that MY Jack Russell is smarter than YOUR honor student. [votes: 45]  Fritter's Mom
A baby gate??? That's all you got??? You don't got Jack! [votes: 44]  Bailey
 
Honorable Mentions
  • Everybody Limbo!!! [votes: 28]
  • UNDERdog' [votes: 25]
  • No one keeps baby in a cage! [votes: 25]
  • It might be a baby gate but it ain't a puppy gate! [votes: 24]
  • The Great Escape. [votes: 24]
  • Jack be nimble....Jack be quick. [votes: 22]
  • One down. Next up lasers and trip wires. [votes: 20]
  • I'm busting out of this place, I can't do the time! [votes: 17]
  • Does this gate make my butt look big? [votes: 15]
  • Problem solved. [votes: 14]
  • Here kitty kitty. [votes: 14]
  • Don't Fence Me In! [votes: 13]
  • I'm gonna pretend I can't get out so my humans won't feel bad--they're so clueless sometimes. [votes: 11]
  • I should of dug a little deeper!!!!! [votes: 8]
  • Who let the dogs out? [votes: 5]
  • He worries about his tail clearing seemed unfounded at this point. [votes: 4]
  • Under, ACHIEVER! [votes: 4]
  • Jack's got BACK! [votes: 2]
  • I think I saw this in a movie once. [votes: 2]

Results from Contest # 230 [July 22, 2007 - 213 entries]


Contest #230 Psssstttt, we're diggin' out tonight, pass it on. [votes: 46]  Alan Lidbom
They took him to the vet and did WHAT??? [votes: 45]  Nikki26
The REAL Dog Whisperer. [votes: 33]  Divot
 
Honorable Mentions
  • Stop saying that, I am not adopted! [votes: 31]
  • Stop it, honey! I've got to go to work! [votes: 26]
  • Pst, I double dog dare ya!!! [votes: 19]
  • YIKES! We've been framed! [votes: 16]
  • can you keep a secret? [votes: 15]
  • I drink out of the toilet. [votes: 15]
  • She did what??? [votes: 13]
  • ...this one time, at band camp... [votes: 11]
  • We gotta think outside the box. [votes: 10]
  • I'm not one to gossip, but... [votes: 10]
  • Love at first bite. [votes: 8]
  • And the password is... [votes: 8]
  • A cat walked in to a bar... [votes: 7]
  • Look, It's Harry Potter. He passes our portrait everyday and still no bone! [votes: 7]
  • The Voices Are Telling Me To Jump! [votes: 6]
  • Don't forget to give the judge a "big wet one" right after he checks your teeth! [votes: 6]
  • Don't look, but somebody's taking our picture. [votes: 4]
  • Jack the QUIPPER. [votes: 3]

Results from Contest # 229 [July 15, 2007 - 122 entries]


Contest #229 I'm tellin' ya Jack...these stripes were...not...here an hour ago! [votes: 50]  Brenda
You'll be fine. I've ruined plenty of blinds. [votes: 37]  Clayton
Shhh, It's the mailman! [votes: 34]  Diane
 
Honorable Mentions
  • Whatever it is...let's kill it! [votes: 34]
  • Hey Pop, did you have to wear a harness when you were little? [votes: 27]
  • Love is blind. [votes: 20]
  • When you see the cat's shadow-it's lunch time. [votes: 20]
  • Stay away from the light. It got Bud back in '99. [votes: 13]
  • So, uh, whatcha in for? [votes: 13]
  • They're Back !!! [votes: 10]
  • I think we're alone now. [votes: 10]
  • How do you make a venetian blind? Poke him in the eyes! [votes: 10]
  • Reckon we're about to be abducted by aliens, hope there's cats there! [votes: 9]
  • The gig is up; remember to blame it on the kid. [votes: 8]
  • You've got the brawn, I've got the brains...let's make lots of money. [votes: 7]
  • What did ya say?? Man, you made me lose count!! [votes: 6]
  • Someday all this will be yours. [votes: 5]

Results from Contest # 228 [July 8, 2007 - 244 entries]


Contest #228 Excuse me - did you say I am NOT going on vacation with you? [votes: 62]  dextersmom
Don't cha wish your jack was HOT like ME !!!! [votes: 44]  Roxy
'Jack' Nicholson. [votes: 37]  Pat
 
Honorable Mentions
  • Too cool for obedience school. [votes: 34]
  • What makes you think Nationals went to my head? [votes: 20]
  • My future's so bright, I gotta wear shades. [votes: 17]
  • I make this look good... [votes: 17]
  • Single Jack Male seeking Single Jack Female, vaccinations not important. [votes: 16]
  • Jack of all Shades. [votes: 15]
  • Jack-of-all-SHADES. [votes: 14]
  • No autographs please! [votes: 11]
  • Let's do lunch. I'll have my people get with your people. [votes: 11]
  • I wear my sunglasses at night... [votes: 11]
  • Seeking female: must be house broken, 51% white, nice gait....strays need not apply. [votes: 11]
  • If you ain't got these glasses, you ain't got jack. [votes: 8]
  • Jack makes a spectacle of himself for attention. [votes: 8]
  • You can't handle the truth about the cat! [votes: 6]
  • Jackie Oh! [votes: 4]
  • Don't it make my brown eyes BLUE? [votes: 4]
  • I ain't nothin' but a hound dog. [votes: 4]
  • Don't you get tired of looking at such total PERFECTION? [votes: 3]
  • Let's take it outside... [votes: 2]
  • Objects (cats) seen may appear closer than they seem. [votes: 1]

Results from Contest # 227 [July 1, 2007 - 298 entries]


Contest #227 One of the disadvantages of being a short legged Jack Russell! [votes: 49]  Helen Mason
Get in my belly... [votes: 41]  skip
I think I can, I think I can, I think I can... [votes: 30]  Martha
 
Honorable Mentions
  • The Spotted Chef !! [votes: 25]
  • No, my instructions clearly specified to put this on the floor... [votes: 24]
  • It's Shake-n-Bake and I helped! [votes: 24]
  • Is this a fat joke? [votes: 22]
  • When will the cat be done? [votes: 20]
  • Can I get a little help here? [votes: 18]
  • Jack the 'Sniffer'. [votes: 16]
  • I'll have mine rare - right now. [votes: 15]
  • Here chicky, chicky, chicky... [votes: 9]
  • Fatal Attraction. [votes: 8]
  • Bacon, bacon, bacon! [votes: 7]
  • I like mine with grey hair and a bushy tail! [votes: 7]
  • Jack realizes that there's a down side to stove top cooking. [votes: 6]
  • 1 For You, 2 For Me. [votes: 5]

Results from Contest # 226 [June 24, 2007 - 224 entries]


Contest #226 Jack be nimble, Jack be quick, Jack passed out on a big ol' brick. [votes: 93]  Hailey Girl
One tequila, two tequila, three tequila, Floor!!  Bobbie Jo
Slumber jack. [votes: 36]  Michelle
 
Honorable Mentions
  • When you're really tired, any pillow will do. [votes: 30]
  • Jack the Napper. [votes: 19]
  • Did I get a pillow for Christmas? Noooo, another collar! [votes: 19]
  • Jack listened carefully to the brick for hours, yet he still heard nothing. [votes: 19]
  • Dog Tired. [votes: 19]
  • I feel like Paris Hilton in prison. All I did was bite off the end of the cat's tail!! [votes: 16]
  • This is NOT a Holiday Inn Express!!! [votes: 14]
  • My head is on the chopping block again. [votes: 13]
  • Let sleeping dogs lie. [votes: 13]
  • Dog days of summer. [votes: 11]
  • Mom always said there would be days like this. [votes: 11]
  • Jack on Board! [votes: 9]
  • Jack is finally thinking concrete thoughts! [votes: 9]
  • Play Hard, Rest Well! [votes: 7]
  • I should have waited the 30 minutes after eating before swimming! [votes: 6]
  • Union Break. [votes: 5]
  • I am tired of being 51% white. [votes: 5]
  • A chip off the ol' block... [votes: 4]
  • I love the smell of Brick in the Mornin. [votes: 4]
  • Yeah, I'm probably too hot but I don't know it yet. [votes: 3]
  • This is not as comfortable as it may seem. [votes: 2]

Results from Contest # 225 [June 17, 2007 - 279 entries]


Contest #225 Hi, I'm Jack Russell, you must be Jack Daniels. [votes: 59]  Tam
Told you not to bite the lamp cord. [votes: 53]  Herman
Wow buddy, that must have been one great party! [votes: 41]  Thom
 
Honorable Mentions
  • Stuck your head out at the car wash didn't you? [votes: 38]
  • Yes, it was a skunk... anymore dumb questions???? [votes: 36]
  • You short haired Jacks just roll out of bed and look good. It takes a lot of work for me. [votes: 35]
  • Just don't ask... [votes: 23]
  • If Lindsay Lohan was a Jack Russell. [votes: 22]
  • Chased the ole' black cat with the white stripe did ya. Smell you later! [votes: 12]
  • One eyed Jack. [votes: 10]
  • I'm the favorite. Pass it on. [votes: 9]
  • This secret will make your hair stand on end. [votes: 9]
  • Notice: this jack russell terrier has just woken up. do not disturb. may pee on carpet. [votes: 8]
  • Brylcream... a little dab would do you good. [votes: 8]
  • I know I look and smell bad, but you should see the other guy! [votes: 8]
  • Guess which Jack used the name brand dog shampoo! [votes: 8]
  • Do I HAVE to give Aunty a kiss? [votes: 5]
  • MOM!!! Jack's been into your conditioner again! [votes: 4]
  • Tell me again. How did you sneek out? [votes: 4]
  • Before and After. [votes: 3]
  • Go and clean your room. Now! [votes: 1]
  • Out chasing squirrels again Jack? [votes: 1]

Results from Contest # 224 [June 10, 2007 - 277 entries]


Contest #224 See, I told you the cat was heavier than the muffin. [votes: 98]  Rick and Rox's Mom
This is their sick way of getting us to take a bath. [votes: 60]  branden
The 5-second rule still applies...doesn't it??? [votes: 43]  Bailey
 
Honorable Mentions
  • If we stare at it long enough, it will come to us... [votes: 33]
  • Her cooking's so bad I was sure it would sink! [votes: 21]
  • It's not worth it, Joe ... there' a plate full of 'em on the table! [votes: 21]
  • Do You Know The Muffin Man?? [votes: 18]
  • Damn Cinnabons. Somebody's gettin' wet. [votes: 18]
  • Double The Pleasure, Double the Fun. [votes: 17]
  • Did it move? I think it moved, yep, it moved! [votes: 15]
  • Is it worth it? [votes: 12]
  • I feel sorry for the cat, but he let go of the muffin. [votes: 10]
  • The silence of the Jacks... [votes: 10]
  • Top o' the muffin to ya! [votes: 8]
  • Trick Or Treat? [votes: 5]
  • Going, going scone! [votes: 5]
  • Everyone outta the pool. [votes: 3]
  • You know Mom's just inside the door with a camera, right? [votes: 3]

Results from Contest # 223 [June 3, 2007 - 373 entries]


Contest #223 You think you're going without ME--you don't know JACK!! [votes: 77]  Linda
You are not leaving me with Grandma, again! [votes: 69]  Tammy
What happens at Nationals...Stays at Nationals... [votes: 30]  SpitFyre
 
Honorable Mentions
  • Hit the Road Jack...! [votes: 24]
  • How to get your JRT X-Rayed for free! [votes: 22]
  • No Jack Left Behind! [votes: 20]
  • Are we there yet??? [votes: 20]
  • All my bags are Jacked...I'm ready to go... [votes: 19]
  • I'm going to DISNEY WORLD!!! [votes: 16]
  • Jack Pack [votes: 15]
  • Some day my mom will buy me a travel crate. [votes: 14]
  • Jack the Tripper! [votes: 14]
  • What the?? Hmm, last thing I remember is closing my eyes, then a zipping sound... [votes: 14]
  • Have Jack, will travel. [votes: 11]
  • We all come with our own baggage! [votes: 10]
  • The best traveling companion anyone can have. [votes: 9]
  • Do you think they will serve peanuts on this flight? [votes: 6]
  • Will I fit in the overhead bin? [votes: 6]
  • Homeward Bound [votes: 6]
  • Curses foiled again. [votes: 6]
  • Hopefully my people remember to check this as a carry on this time. [votes: 5]
  • I hate flying coach... [votes: 4]
  • I've always wanted to see France. [votes: 3]
  • Time to pack for the next terrier trial. [votes: 3]
  • How much extra for carry-on ticket? [votes: 1]

Results from Contest # 222 [May 27, 2007 - 304 entries]


Contest #222 How many Jacks does it take to flood the bathroom? [votes: 57]  Charlotte
Do we want "C"ookies or "H"amburger? [votes: 53]  Barb Eales
If I can reach that razor, we'll shave that cat while he sleeps! [votes: 52]  sam's dad
 
Honorable Mentions
  • I've seen them... they stand here and the indoor rain comes. [votes: 49]
  • JACK-CUZZI. [votes: 49]
  • Trust me. I know what I'm doing. [votes: 42]
  • It was horrible! NEVER turn this lever to the right. [votes: 39]
  • Curiosity Cleaned the Jack. [votes: 32]
  • I double dog dare you! [votes: 22]
  • Who needs a groomer, we can do this ourself. [votes: 14]
  • Hey I wonder what this does? [votes: 11]
  • You got the stopper in? How long do you think it will take to fill the room up? [votes: 7]
  • If you start singing, I'm outta here. [votes: 6]
  • Darn! Still too short to reach the faucet! [votes: 6]
  • Gonna wash that Jack right outta my hair! [votes: 5]
  • Group shower, I saw this once in a late night movie! [votes: 5]
  • No shower for me thanks, I have conformation next week! [votes: 1]

Results from Contest # 221 [May 20, 2007 - 267 entries]


Contest #221 Are you sure this is a baby tooth? [votes: 45]  Daniel
Jack's reinactment of "Lady and the Tramp" was not going as planned... [votes: 38]  Erin
No, I'M taking YOU for a walk. [votes: 38]  Arthur
 
Honorable Mentions
  • Everybody LIMBO! [votes: 32]
  • Jack and Jill devise a plan to tie up the cat. [votes: 31]
  • mine mine mine mine [votes: 29]
  • You said "no strings attached"! [votes: 24]
  • Oh Yeah! That's got it. Thanks man, that piece of cat has been stuck in there for days! [votes: 22]
  • Hey, we agreed what mine is mine and what yours is mine. [votes: 19]
  • This is BORING, let's go find a squirrel. [votes: 17]
  • I'm really at the end of my rope dear. [votes: 13]
  • Time out! I'm caught on something... [votes: 10]
  • oops..I think I swallowed it! [votes: 7]
  • This looked better in the movie. [votes: 7]
  • It's going to be a long night. [votes: 6]
  • Field day at obedience school. [votes: 6]
  • Mom went on a vacation, and all she brought back was this rope...burp...with a cat attached. [votes: 5]
  • Sure would be nice to have thumbs eh? [votes: 4]

Results from Contest # 220 [May 13, 2007 - 211 entries]


Contest #220 Spot, Spot, Spot and their other brother, SpotLESS. [votes: 64]  Pat
We give this food two tails up. [votes: 55]  hwood
You idiot! That glue didn't make us "super!" [votes: 54]  Daniel
 
Honorable Mentions
  • X marks the Spot!! [votes: 28]
  • We're losing him doctor! [votes: 25]
  • I know we can do it if we put our heads together! [votes: 24]
  • Hey guys, last one to finish is a cat lover! [votes: 24]
  • JRT Pinwheel Dinner - Eat clockwise. [votes: 17]
  • A Meeting of the Minds. [votes: 16]
  • Home cookin'! They'll never recall this!!! [votes: 16]
  • You realize 6 months from now, we won't be able to do this... [votes: 13]
  • You two get the arms. We got the legs. [votes: 9]
  • Stop! Stop! My spots are in there! [votes: 9]
  • Last one to eat loses his spots! [votes: 5]
  • Only surgery could separate them, or the well placed cat. [votes: 4]
  • What's for dinner? [votes: 4]

Results from Contest # 219 [May 6, 2007 - 348 entries]


Contest #219 You lied in your on-line profile.. didn't you? [votes: 51]  Jack 1
Yes, I ordered my steak rare, but I didn't expect this! [votes: 38]  Megan R
To tip, or not to tip, that is the question. [votes: 32]  swtmdmboo
 
Honorable Mentions
  • This pasture isn't big enough for the two of us. [votes: 32]
  • Less than 50% white...you may be excused from the ring. [votes: 31]
  • You're the biggest broken coat I've ever seen! [votes: 30]
  • ..I said shooo!!, beat it!!........this is my turf steak boy!! [votes: 26]
  • My milk shake brings all the jacks to the yard... [votes: 24]
  • Whoa, what did I just step in? [votes: 20]
  • Get in my belly! [votes: 18]
  • Ima gonna chase ya', then ima gonna eat ya'! [votes: 17]
  • So much cow... so little time [votes: 15]
  • And this one time in obedience camp... [votes: 14]
  • Wow mom went all out with dinner!! [votes: 8]
  • Didn't we have this same conversation yesterday? [votes: 8]
  • Go on .. keep off the grass! [votes: 6]
  • He ain't heavy, he's my brother! [votes: 5]
  • Jack had to confess that he was lactose intolerant [votes: 5]
  • Somebody bring me a pail... [votes: 4]
  • That's it! I want a pay raise! [votes: 2]

Results from Contest # 218 [April 29, 2007 - 415 entries]


Contest #218 I don't know why they call 'em blinds, I can see right through them. [votes: 66]  Bailey
OK the fly is dead. [votes: 49]  Lori Wells
How much is that doggie in the window? [votes: 38]  Pat
 
Honorable Mentions
  • Heeeree's Johnny! [votes: 37]
  • I hate to interrupt, but this is important... [votes: 33]
  • OOPS, wrong basement. [votes: 26]
  • Dang, this looks easy when the cat does it! [votes: 17]
  • Love is blinds. [votes: 16]
  • No thanks, sorry, I'm just window shopping. [votes: 13]
  • Heh, the neighbor's cat doesn't want to play anymore. He just lays there... [votes: 13]
  • Lets just say this is the result a long night and 1 too many doggy biscuits. [votes: 12]
  • Avon Calling! [votes: 11]
  • I knew this was a bad idea. [votes: 11]
  • You know for a few pennies more, an elizabethan collar would work. [votes: 10]
  • I think Mom is going to be very mad at me. [votes: 10]
  • The doggie door was in use. [votes: 10]
  • Blinded by his own curosity, Jack just had to peek! [votes: 10]
  • Oh ya....I'm watchin you.... [votes: 9]
  • I know what you did last summer. [votes: 9]
  • Today is so not my day! [votes: 9]
  • Heh, why are you sitting on my porcelain water bowl? [votes: 8]
  • What a beautiful mess i made. [votes: 7]
  • Who put this shade in my doggy door? [votes: 7]
  • Wait a minute....am I coming or am I going? [votes: 2]

Results from Contest # 217 [April 22, 2007 - 285 entries]


Contest #217 Jumpin Jack Splash. [votes: 74]  Christa
Dang! I hate it when they hook it up to the air hose. [votes: 67]  Shelby GT
I'm Ready!!!!! Hit the switch... [votes: 34]  Donna4Jacks
 
Honorable Mentions
  • Hose your daddy? [votes: 26]
  • Hit the remote, I'm on pause! [votes: 24]
  • You've watered your last lawn... [votes: 23]
  • Die alien, die. [votes: 21]
  • Ha HA!!! You will NEVER Bathe me!!! [votes: 19]
  • You mark my territory, and I'll mark yours! [votes: 18]
  • Jack be nimble, Jack be quick. [votes: 15]
  • Yeow!!! Cold water! [votes: 15]
  • Man, this one's gonna hurt... [votes: 13]
  • Uh oh...no water! [votes: 11]
  • What does a guy have to do to get a drink around here? [votes: 9]
  • Jack was very confused by the invisible water. [votes: 9]
  • This landing looks like it might be painful - Houston we have a problem! [votes: 8]
  • Leap of faith. [votes: 6]
  • Don't leave me hanging in a situation like this! [votes: 5]
  • Waiting for the geyser. [votes: 4]
  • Matrix. [votes: 4]
  • What a fun way to get a bath! [votes: 3]
  • Watering, SPOT! [votes: 1]

Results from Contest # 216 [April 15, 2007 - 358 entries]


Contest #216 1st place Somebody moved my doggy door...not funny. [votes: 75]  anonymous
2nd place Who says white dogs can't jump? [votes: 64]  RileyBean
3rd place Gotta go, gotta go, gotta go right now. [votes: 41]  Nancy
 
Honorable Mentions
  • Jump up, bark at the mailman. Jump up, bark at the mailman. Jump up, bark at the mailman. [votes: 37]
  • Jumpin' Jack! [votes: 25]
  • Don't leave meee!!! [votes: 24]
  • Mom's home!! [votes: 23]
  • I can't see jack out of this little window. [votes: 19]
  • The Mail Man is Here! The Mail Man is Here! [votes: 17]
  • Mom, come quick, there's a man with a big cardboard check outside. [votes: 17]
  • Pizza's here! [votes: 14]
  • Has anyone let the dog out this morning? [votes: 11]
  • It's Dominos, open the door. [votes: 9]
  • Can I see some ID, please? [votes: 9]
  • yoo hoo, Mr. Postman... [votes: 8]
  • What's the password? [votes: 8]
  • She's here! Everybody hide! [votes: 8]
  • Wash on delicate, hang to dry. [votes: 8]
  • Jack be nimble... [votes: 7]
  • Bark, Who goes there??? [votes: 6]
  • There's a girl scout at our door!....order more cookies!! [votes: 5]
  • Heeeeere's Johnny! [votes: 4]
  • Mom told me not to let stangers in while she was gone. [votes: 1]

Results from Contest # 215 [April 8, 2007 - 276 entries]


Contest #215 If anybody asks, we did NOT do it, we were taking naps.... [votes: 67]  Dusty's Mom
Come on!! You run like a Cat! [votes: 58]  Mercedes
If you can't keep up with the little white dogs, stay on the porch!  Divot
 
Honorable Mentions
  • Run Forrest! Run!!! [votes: 39]
  • I think I stepped in something. [votes: 27]
  • You put your left leg in.. you put your left leg out... [votes: 26]
  • Jacks new jogging partner is a little rusty... [votes: 26]
  • Dude! Mom's gonna kill you when she see's how muddy you got! [votes: 21]
  • Don't touch me with those muddy paws--I'm wearing WHITE! [votes: 21]
  • And then she said I was insensitive! Do you think I'm insensitive? [votes: 21]
  • Anything you can do I can do better! [votes: 18]
  • You got any last requests before you eat my dust? [votes: 17]
  • JRT trials are second on the left, straight ahead for 1 mile. [votes: 14]
  • Thelma and Louise. [votes: 10]
  • Take a look at my girl friend, she's the only one I got. [votes: 10]
  • When we get home, you wanna rip that perfectly good toy that mom bought us yesterday up? [votes: 9]
  • Run, run, now feel the burn! [votes: 8]
  • Happy Feet. [votes: 6]
  • Lets Do Some Hunting! [votes: 4]
  • Who let the dogs out? [votes: 4]

Results from Contest # 214 [April 1, 2007 - 306 entries]


Contest #214 First I'm gonna de-squeak ya, then I'm gonna eat ya. [votes: 74]  Bailey
Who's Your Daddy? SAY IT !!!! SAY IT !!!! [votes: 35]  Roxy
Beef...It's what's for dinner... [votes: 35]  SpitFyre
 
Honorable Mentions
  • Don't you udder another word! [votes: 28]
  • All toys must die. [votes: 27]
  • My Precious!! [votes: 24]
  • Mad Cow, Mad Cow! [votes: 22]
  • Now I have you, you cow-ard! [votes: 21]
  • Resistance is futile. [votes: 17]
  • Jack is lactose intolerant. [votes: 16]
  • Snap plastic leg (part A) into body (part B) and your new cow toy is ready for hours of enjoyment! [votes: 14]
  • Where's the beef? [votes: 13]
  • Any last words? [votes: 12]
  • Die before I kill you. [votes: 12]
  • Just wait 'till they fire up the grill. [votes: 9]
  • Do you know the muffin man? [votes: 7]
  • Hey...this one's out of milk!! [votes: 6]
  • Any last requests? A blindfold, maybe? [votes: 5]
  • The cow was mislead on how the milking was done. [votes: 4]
  • Who's the dummy now? [votes: 4]
  • What a non creative caption! [votes: 1]

Results from Contest # 213 [March 25, 2007 - 248 entries]


Contest #213 That St. Bernard next door must be getting another bath. [votes: 46]  Dillon
Jack contemplates how he will attack each and every one... [votes: 41]  Julz
So many bubbles so little time. [votes: 40]  Carol
 
Honorable Mentions
  • I don't think the weatherpeople saw this one coming... [votes: 37]
  • If only we could open the door. [votes: 30]
  • Look.....at all those balls. [votes: 27]
  • Sorry kid... bubbles give me gas. [votes: 24]
  • This is way better than snow. [votes: 22]
  • I don't think we're in Kansas anymore, Toto!! [votes: 18]
  • One day my son, all this shall be yours! [votes: 16]
  • Don't worry kid, when you get older I'll teach you how to play with those. [votes: 13]
  • After they clean you with the soap bubbles, they put a diaper on you! [votes: 12]
  • Yeah, I want to go outside too. You share my pain, brother. [votes: 12]
  • Cheap entertainment. [votes: 11]
  • They are so pretty... I wonder what they TASTE like! [votes: 10]
  • The sky is falling, the sky is falling! [votes: 9]
  • How many do you think there are? [votes: 6]
  • Connect the dots. [votes: 5]
  • It's the most beautiful sight I've ever seen! [votes: 5]
  • How many of those do YOU see...? [votes: 4]

Results from Contest # 212 [March 18, 2007 - 321 entries]


Contest #212 A little ditty about Jack and Diane. [votes: 47]  Amy C
Are we there yet? [votes: 44]  KaiserJack
I know she put the groceries back here. [votes: 37]  Jdurbin
 
Honorable Mentions
  • My Jack is smarter than your honor student! [votes: 35]
  • He ain't different, he's my brother. [votes: 29]
  • You gonna puke? I'm gonna puke. [votes: 27]
  • Say hello to my little friend. [votes: 24]
  • Mutt & Jack. [votes: 22]
  • What are you guys doing in the trunk? [votes: 19]
  • Isn't it fun making faces at the cars behind us? [votes: 19]
  • I told you the cat could run really fast... [votes: 15]
  • Seat Belts ! We don't need no stinkin' seat belts! [votes: 15]
  • Oh-oh...Who's drivin'?! [votes: 12]
  • Whatever it is, we didn't do it!! [votes: 12]
  • Roadtrip! [votes: 11]
  • I think I'm going to be car sick. [votes: 8]
  • Stop tailgating me, man!!! [votes: 6]
  • Are you thinking what I'm thinking? [votes: 6]

Results from Contest # 211 [March 11, 2007 - 321 entries]


Contest #211 Jack and a spare. [votes: 96]  Susan
"Lo-Jacks" - A Vehicle Recovery System. [votes: 62]  Terp's Mom
Those suitcases won't be necessary - just our bowls, thank you. [votes: 34]  swtmdmboo
 
Honorable Mentions
  • Tire jacks. [votes: 33]
  • Jacks are always good in case of an emergency. [votes: 28]
  • Nope, no junk in this trunk! [votes: 21]
  • Open carefully, contents under pressure. [votes: 20]
  • BABY! I can explain. [votes: 14]
  • Honey, does our auto insurance cover bite marks & car jackings? [votes: 14]
  • Are we there yet? [votes: 13]
  • Spring Break: Jacks gone Wild. [votes: 10]
  • ROAD TRIP [votes: 10]
  • 125 Horsies up front, two doggies in back. [votes: 10]
  • Trunk Drivers. [votes: 10]
  • Yeah, we're bootylicious. [votes: 9]
  • Luggage? There's no room for luggage in here. [votes: 9]
  • We've been very bad... [votes: 7]
  • This sure beats sticking our heads out the window! [votes: 7]
  • Modern-day fox hunting... [votes: 6]
  • I heard the hotel rooms in Europe were small, but geez! [votes: 4]
  • Free at last. [votes: 4]

Results from Contest # 210 [March 4, 2007 - 357 entries]


Contest #210 Lumber jack! [votes: 48]  JJ
Hi, I am a single male Jack who enjoys long walks, good weather and nice trees. [votes: 47]  Paul M
Don't worry. I'll be here when that cat comes down. [votes: 41]  TimT
 
Honorable Mentions
  • 2007 Sexy JRT Calender [votes: 40]
  • Jack's senior picture. [votes: 28]
  • Sooner or later, it has to come down. [votes: 25]
  • Keep on walking buddy, nothing to see here. [votes: 20]
  • When I stand like this does it make me look fat? [votes: 20]
  • My tree... This is my tree... [votes: 19]
  • Can't a guy get a moment of privacy here? [votes: 17]
  • I like long walks on the leash and a food bowl for two. [votes: 16]
  • You hide and I will seek. [votes: 12]
  • Work it girl! Strike a pose! [votes: 12]
  • What goes up, must come down. [votes: 12]
  • Give me an hour, I'll turn this tree into a beautiful deck. [votes: 11]
  • ...barking up the right tree. [votes: 11]
  • This tree is all bark and no bite!! [votes: 10]
  • So many trees, so little time. [votes: 9]
  • This should get me on the cover of True Grit! [votes: 8]
  • Now this is my kind of urinal! [votes: 7]
  • Sorry, try the next one... this one's occupied. [votes: 5]
  • ah no ... someone been here before! [votes: 1]

Results from Contest # 209 [February 25, 2007 - 333 entries]


Contest #209 5 jacks and a jill. [votes: 59]  swtmdmboo
Dora's Last Exploration. [votes: 53]  Nick Shadursy
You pull her to safety, I'll check her pulse. [votes: 50]  Dianna Gardner
 
Honorable Mentions
  • CSI: Jack Russell Terrier. [votes: 34]
  • Dora gets explored! [votes: 29]
  • Bad pups, bad pups, whatcha gonna do, whatcha gonna do when they come for you? [votes: 28]
  • I don't like her. She seems fake. [votes: 27]
  • Let's crate 'er! [votes: 26]
  • Dora the Explorer meets Jack the Mauler and his cousins, Vinny, Pete, Frank and Paulo. [votes: 23]
  • How do we know for sure she's not one of the "Others"? [votes: 19]
  • Cabbage Patch Jacks! [votes: 16]
  • Dora is no longer the Explorer. [votes: 16]
  • Tastes like pollo! [votes: 15]
  • Jack the GRIPPER! [votes: 15]
  • Silence of the Dolls. [votes: 14]
  • OH Boy - finally somebody our own size to play with. [votes: 13]
  • Guys and Doll. [votes: 13]
  • She'll never make it in Conformation. [votes: 7]
 

Results from Contest # 208 [February 18, 2007 - 259 entries]


Contest #208 Punxsutawney Jack. [votes: 111]  Kathy
Be Very Quiet, we're hunting Wabbit! [votes: 60]  Matt Haring
Nope, Not in Florida Yet. Keep digging. [votes: 47]  Donna4Jacks
 
Honorable Mentions
  • I'm not coming out until you apologize. [votes: 33]
  • The ground hog sleeps with the fishes. [votes: 24]
  • Had to get away from the wife and kids for awhile. [votes: 20]
  • I'm all for Global Warming. [votes: 18]
  • Out last, Out wit, Out play. [votes: 15]
  • Now is the winter of my discontent... [votes: 15]
  • Ah! light at the end of the tunnel! [votes: 14]
  • Occupied. [votes: 12]
  • Baby it's cold outside!! [votes: 11]
  • The weather outside is frightful, but here its so delightful. [votes: 11]
  • How to Housebreak Your Dog in Just One Hour. [votes: 10]
  • Closer Closer just a little closer. [votes: 8]
  • Go to the ground winter edition. [votes: 7]
  • Snow Day! [votes: 6]
  • Prey goes into hole, Jack goes into hole, our JACK, farewell and adieu to the wee little PREY. [votes: 4]

Results from Contest # 207 [February 11, 2007 - 452 entries]


Contest #207 Can you hear me NOW? [votes: 93]  steff
Hey there pussy cat, woahhh woaahhhh wooaahh! [votes: 45]  Rammer
CCCCCCCAAAAAAAATTTTTTTT !!!!!!!!!! [votes: 39]  Helen
 
Honorable Mentions
  • Get in my belly!! [votes: 32]
  • Ha ha ha ha!!!! Oh, sorry. You're probably tired of the cat jokes. [votes: 28]
  • If you look reaaallly close you can see your brother. [votes: 28]
  • Sometimes I crack myself up. [votes: 20]
  • HOW MANY TIMES do I have to tell you??!!....WIPE...YOUR...PAWS!!! [votes: 19]
  • Dogs rule, cats drool!!! [votes: 17]
  • Does this tooth look infected to you? [votes: 16]
  • You can't handle the truth! [votes: 15]
  • I've heard that you can shatter cats by singing the right note. [votes: 15]
  • It's a no from me, Sorry, you are not going to Hollywood. [votes: 14]
  • I want BACON!!! [votes: 13]
  • I think the cat is ignoring me! [votes: 8]
  • Cat got your tongue? [votes: 8]
  • ...and you play the part of Little Red Ridinghood. [votes: 7]
  • So, Simon, Paula.....what do you think? [votes: 6]
  • It was just a-ight for me dawg. [votes: 5]
  • Make the cat stop. [votes: 3]
  • Pray. My Dear Prey. [votes: 3]

Results from Contest # 206 [February 4, 2007 - 388 entries]


Contest #206 Jack Frost [votes: 98]  Pat
When you said it was knee deep, I thought you meant MY knees! [votes: 48]  Thom Derry
Where am I? This rabbit hole started in Florida. [votes: 46]  Sierra
 
Honorable Mentions
  • Never thought I'd be glad to be neutered... [votes: 38]
  • SERIOUSLY!!! It's snowing, I'm done going potty. LET ME IN!!!! [votes: 36]
  • I went to ground and came up in Alaska. [votes: 28]
  • Jack-sicle [votes: 28]
  • If I lick my nose, will it stick? [votes: 23]
  • I'm making yellow snow right now. [votes: 22]
  • Chili dog! [votes: 19]
  • Um...could someone call me a St. Bernard? [votes: 17]
  • Ice Ice Baby [votes: 14]
  • Global Warming? What Global Warming? [votes: 13]
  • And they wonder why we are hard to housebreak. [votes: 12]
  • Can you see me now? [votes: 12]
  • Baby it's cold outside. [votes: 9]
  • 6 more weeks of winter??? REALLY???? [votes: 9]
  • I'm thinking Cancun. [votes: 9]
  • Thinking Warm Thoughts !! Thinking Warm Thoughts. [votes: 9]
  • I hope that chicken noodle soup is ready. [votes: 8]
  • Let it snow, let is snow, let it snow. [votes: 7]
  • Hey, we like to dig INTO stuff, not OUT of stuff! [votes: 6]
  • Definitely 51% white. [votes: 6]
  • Al Gore, I'm coming for you!!!! [votes: 5]
  • Periscope Up! [votes: 5]
  • Frigid dare. [votes: 4]
  • Peek...a choo! [votes: 4]
  • Look mom no body. [votes: 4]

Results from Contest # 205 [January 28, 2007 - 359 entries]


Contest #205 Hush little russell don't say a word, Momma's gonna buy you a flying squirrel! [votes: 52]  Roxy
Don't make me turn this stroller around!!! [votes: 43]  Megan Rees
Look at me when I am talking to you. [votes: 37]  Jack
 
Honorable Mentions
  • Don't make me call your father! [votes: 28]
  • I think somebody needs a "time out". [votes: 26]
  • Are you sure he's mine? [votes: 23]
  • I'm old enough to be on a leash mom! [votes: 22]
  • This isn't mine is it? I want a paternity test. [votes: 20]
  • NO mommy no, I don't wanna go the vet. [votes: 20]
  • Yuk! Mom, you have doggy breath! [votes: 20]
  • Ok...once more around the block - then we go home. [votes: 18]
  • What did you say to me? [votes: 15]
  • Don't you eyeball me boy! [votes: 14]
  • A visit from Nanny 911. [votes: 13]
  • I don't like it either, but Consumer Reports says it's safe. [votes: 11]
  • It wasn't funny yesterday and it's still not funny today! [votes: 10]
  • Don't be a baby, a spit bath never hurt anyone. [votes: 8]
  • Rosemary's Baby. [votes: 7]
  • ... and when they come to claim the seat just growl....with conviction. [votes: 7]
  • Jack shows his nurturing side. [votes: 6]
  • Please... I beg you...do it for your Mother...STOP BARKING!!! [votes: 6]
  • You're suppose to push from the back, Jack!! [votes: 6]
  • How bad do you want to be in the fraternity? [votes: 4]

Results from Contest # 204 [January 21, 2007 - 275 entries]


Contest #204 Lumber Jacks. [votes: 81]  Bailey
When we get to shore, remember "I" found it first! [votes: 48]  Thom Derry
Cold water, a nice stick, my best buddy....LIFE IS GOOD!!! [votes: 46]  Jim Long
 
Honorable Mentions
  • Let's swim real fast and trip the duck. [votes: 41]
  • This counts as our baths, right??? [votes: 36]
  • We always STICK together! [votes: 28]
  • How did I ever let you talk me into this...i just wanted to chase the squirrels. [votes: 27]
  • United We Swim -- Divided We Sink. [votes: 19]
  • You keep saying dog paddle, dog paddle!!! What do you think I am doing? [votes: 18]
  • I'm tired of filming this stupid Disney movie. [votes: 17]
  • Dog-Paddling. [votes: 16]
  • I can't believe I got the short end of the stick! [votes: 15]
  • We're gonna need a bigger boat. [votes: 12]
  • Are you pulling or pushing? [votes: 12]
  • When the Captain says "Don't touch that" he means it !!!! [votes: 11]
  • Why is this stick so important? [votes: 10]
  • Uh, I don't know about this flotation device, how much further to land? [votes: 6]
  • I'm thinking "Pappillon". [votes: 6]
  • Job competition. [votes: 4]
  • It may not be mud, but we can roll in the dirt afterwards. [votes: 3]
  • Wanna split it...? [votes: 2]
  • Were just going with the flow. [votes: 1]

Results from Contest # 203 [January 14, 2007 - 268 entries]


Contest #203 I still don't understand why they put a DOG BED on my couch. [votes: 111]  Donna4Jacks
Another $39.99 well spent! [votes: 72]  trevor
Bed for sale - very soft - no view. [votes: 35]  JO
 
Honorable Mentions
  • If it's so comfortable - You sleep in it! [votes: 31]
  • Thinking outside the box. [votes: 29]
  • Always go for the window seat. [votes: 26]
  • Nope, not after the cat slept in it. [votes: 23]
  • How do you expect me to keep an eye on things from down there? [votes: 23]
  • Just in case I fall. [votes: 19]
  • I like livin' on-the-edge! [votes: 17]
  • Snoopy syndrome strikes again. [votes: 14]
  • Anywhere Jack lays his head is his home. [votes: 13]
  • Cat smell, cat smell, jack no sleep in cat smell. [votes: 9]
  • Example of separation anxiety. [votes: 8]
  • Bunk beds. [votes: 7]
  • Another failed idea! [votes: 5]
  • Don't be fooled by imitations. [votes: 5]
  • Sleeping in the loft. [votes: 4]
  • I missed. [votes: 3]
  • I do all my own stunts! [votes: 3]

Results from Contest # 202 [January 7, 2007 - 393 entries]


Contest #202 Russell, Jack Russell. [votes: 126]  Sindy
Every girl's crazy about a sharp dressed jack. [votes: 41]  rebecca91
I'm bringing SEXY back! [votes: 33]  Riley B
 
Honorable Mentions
  • We meet again, Mr. Bond. [votes: 30]
  • Frankly my dear, I don't give a damn. [votes: 26]
  • I'll take my kibble shaken... not stirred. [votes: 24]
  • I'm too sexy for my shirt. [votes: 23]
  • All dressed up with nothing to chew. [votes: 20]
  • My name is JACK and i will be your waiter tonight. [votes: 20]
  • The difference between me and you is, I make this look GOOD. [votes: 19]
  • Simply irresistible! [votes: 10]
  • I doo, I doo, can I lick the bride? [votes: 8]
  • Did you say sauteed feline? That sounds good, I'll have that! [votes: 8]
  • Jackolicious [votes: 6]
  • I do, I don't, I do, I don't...I can't do this! Wait!! Isn't there going to be cake? I DO!!!! [votes: 6]
  • That was one heck of a party! I think I kissed the cat... [votes: 6]
  • These confirmation awards ceremonies are getting a little to formal... know what I mean? [votes: 6]
  • Where the ladies at? [votes: 5]
  • Got my tie and tails... [votes: 5]
  • One of my better prom dates! [votes: 4]
  • For better or worse, for richer or poorer... [votes: 3]
  • A mischief in disguise. [votes: 3]
  • My bowl is a black tie affair. [votes: 2]
  • By Invitation Only [votes: 1]

Caption Contests Results for 2014, 2013, 2012, 2011, 2010, 2009, 2008, 2007, 2006, 2005, 2004, 2003