Jack Russell Terrier Club of America - JRTCA Preserve, Protect and Work the Jack Russell Terrier

Jack Russell Picture Caption Contest Results

The following are the results from our Picture Caption Contests for 2007.

Results from Contest # 252 [December 30, 2007 - 178 entries]

Contest #252 1st place PUPsicle. [votes: 50]  Pat
2nd place You have a little something on your chin. [votes: 44]  Chris
3rd place 5...4...3...2...1... Happy New Year!! (smooch) [votes: 33]  Greggo
Honorable Mentions
  • Takes a lickin', keeps on tickin'. [votes: 26]
  • I hate spit baths. [votes: 21]
  • No tongues! NOOOOO tongues!! [votes: 14]
  • Don't worry...I'm a trained professional. [votes: 12]
  • One down, ten to go. [votes: 11]
  • Who doesn't love the new year baby?! [votes: 11]
  • Do you think this will get us on the internet? [votes: 11]
  • Spot-checking. [votes: 10]
  • I love you man! [votes: 9]
  • Jack be nimble, jack be lick! [votes: 9]
  • Curbside tongue service. [votes: 6]
  • I don't know. Ask your mom. [votes: 3]
  • I surrender!!!! [votes: 2]

Results from Contest # 251 [December 23, 2007 - 108 entries]

Contest #251 1st place You vill NOT take zees tennis ball! Nein! Nein! [votes: 45]  Kirie W
2nd place My human has too much time on his hands. [votes: 32]  Pat
3rd place It's like eating a squirrel. Once you get the fur off, it's nice and chewy. [votes: 29]  cred
Honorable Mentions
  • The hat gets returned, but I keep the ball! [votes: 21]
  • Jack In The Hat. [votes: 20]
  • My hat's too big and my mouth's too small! [votes: 20]
  • Yes, I Drink Alone! [votes: 13]
  • Couches, tennis balls and Harley Davidson hats, these are a few of my favorite things. [votes: 13]
  • Are you sure this is gonna impress the judges???? [votes: 11]
  • Why do people think this is so funny? [votes: 9]
  • Open mouth, insert ball. [votes: 9]
  • Has the ball dropped yet? [votes: 9]
  • Newest member of the "Jacks of Columbus". [votes: 7]
  • Back away, there is nothing to see here. [votes: 6]
  • I wear this so they can spot me in the snow. [votes: 4]

Results from Contest # 250 [December 16, 2007 - 190 entries]

Contest #250 1st place This means she gave the baby my chew toy again. I hate when she loses her glasses! [votes: 66]  cred
2nd place If you think this is gonna shut me up you are so wrong. [votes: 43]  Bevansley
3rd place Yeah I took it from the kid and not giving it back. [votes: 27]  anon
Honorable Mentions
  • These thing'll never replace a good crunchy squirrel. [votes: 15]
  • Silence of the Jacks. [votes: 13]
  • And poor Jack needed therapy the rest of his life. [votes: 12]
  • Dude, the cat is laughing at me. [votes: 12]
  • Yelp control. [votes: 11]
  • Got binky? [votes: 8]
  • What she doesn't know, is that I just destroyed her shoe. [votes: 7]
  • This is no way to break my chipmunk habit. [votes: 7]
  • This dingo ate your baby! [votes: 7]
  • Please don't take my binnky. [votes: 5]
  • I better knock it off. I'm gonna have an overbite!!! [votes: 5]
  • Jack love his binky. [votes: 3]
  • Preparing for the baby. [votes: 2]
  • Please save me! Please! [votes: 2]
  • Nobody puts baby in the corner! [votes: 2]
  • 21 Seconds to a Pacified Dog. [votes: 2]

Results from Contest # 249 [December 9, 2007 - 266 entries]

Contest #249 1st place Santa's little YELPER. [votes: 48]  Pat
2nd place Reason 101 why animals attack during the holidays. [votes: 34]  Mandy
3rd place Clearly, Jack has been spending too much time at elfyourself.com. [votes: 25]  vicki
Honorable Mentions
  • This is as jolly as I'm gonna get! [votes: 23]
  • HOHOHO! I left a nice gift under the tree. [votes: 21]
  • I ate the naughty list, because my name was on it. [votes: 19]
  • Yeah, I ate an elf...so what? [votes: 18]
  • This is elfin embarrassing. [votes: 17]
  • I'm only doing this for the presents! [votes: 16]
  • Hand over the cookies or the Fat man gets it. [votes: 12]
  • All I want for christmas is for it to be OVER... [votes: 12]
  • I'm one of Oprah's favorite things! [votes: 7]
  • OH YEAH,... I'M KEEPING A LIST... [votes: 7]
  • I make this look cool. [votes: 6]
  • Elves taste good with ketchup. [votes: 6]
  • I've been a baad elf! [votes: 6]
  • Jack makes an elf of himself. [votes: 6]
  • Hermey wants to be a dentist... [votes: 6]
  • I have the sense people are staring at me this moment... [votes: 4]
  • Pssst....I've got the keys to the sleigh tonight. [votes: 3]
  • All I want for Chistmas is a cat in my teeth! [votes: 3]
  • Ho, Ho, Hole!!!! [votes: 2]
  • Don't mess with the elf! [votes: 1]
  • How about a little elf magic? [votes: 1]

Results from Contest # 248 [December 2, 2007 - 223 entries]

Contest #248 1st place I didn't do it! It was like that when I got here! [votes: 68]  C
2nd place This chicken will not be crossing the road. [votes: 32]  Debbie W
3rd place I killed it...You cook it. [votes: 28]  Bevansley
Honorable Mentions
  • What am I supposed to do with this? [votes: 23]
  • Mom, look what the cat dragged in! [votes: 15]
  • We'll make the breast of it... [votes: 15]
  • Okay, who's next? [votes: 15]
  • Jack Be Nimble Jack Be Quick, Jack Didn't Know What To Do With The Chick. [votes: 14]
  • May I ask what the chicken did? [votes: 14]
  • Another one bites the dust. [votes: 11]
  • That's mine, don't touch it. [votes: 9]
  • Me thinks me killed the chicken, better not look. [votes: 9]
  • Help, the chick has fallen and can't get up!! [votes: 8]
  • Another boring banquet rubber chicken dinner! [votes: 8]
  • Excuse me...I think the chicken has gone bad... [votes: 7]
  • Waiter! Where's my bowl of Chardonnay? [votes: 5]
  • Allow me to say a few words about the chicken. [votes: 5]
  • The new BARF diet. [votes: 4]
  • Chicken tonight! [votes: 1]
  • Chicken......just the way I like it !! [votes: 1]
  • My first go-to-ground win. [votes: 1]

Results from Contest # 247 [November 25, 2007 - 262 entries]

Contest #247 1st place MOM!!!.... HE'S TOUCHING MEEEE!!!! [votes: 77]  Sindy
2nd place I hope this isn't your favorite cat. [votes: 30]  Doug
3rd place oh darn, witnesses... [votes: 25]  jimmy
Honorable Mentions
  • That's it - blind me with the flash - just when I corner the cat? [votes: 20]
  • OK, this is the last time I answer a personal ad! [votes: 20]
  • Go to a happy place! Go to a happy place! Go to a happy place!! [votes: 18]
  • Oh man....this wasn't supposed to be on camera! [votes: 16]
  • I should have known, she's going right for the jewelry. [votes: 15]
  • I like 'em to think they have a chance before I eat 'em. [votes: 15]
  • Somebody please adopt me...NOW! [votes: 14]
  • What did I do? [votes: 12]
  • Jack knew right then that this relationship would never work out. [votes: 11]
  • It's going to be one of those days. [votes: 10]
  • What do you mean your mother is coming for the weekend? [votes: 8]
  • Playing with my food. [votes: 7]
  • When did my life take such a terrible turn? [votes: 6]
  • Tabby was never seen again. [votes: 6]
  • Did I thank you for my new Squeaky toy? [votes: 6]
  • When good cats go bad. [votes: 5]
  • Got Cat???? I do!!! [votes: 4]

Results from Contest # 246 [November 18, 2007 - 214 entries]

Contest #246 1st place It's going to take a while to get the squeaker out of this one! [votes: 45]  Vickie
2nd place Jack thought he better be nice to the new cat. [votes: 37]  vickie
3rd place Keep smiling, they're almost gone. [votes: 31]  Sarah M
Honorable Mentions
  • Wait for it...wait for it... [votes: 21]
  • Jack Spratt could eat no fat; his wife could eat no lean. [votes: 21]
  • Yeah I know Dad, she's not from around here. [votes: 18]
  • I jump around constantly, what is your superpower? [votes: 17]
  • I've got you babe. [votes: 16]
  • One good reason to spay and neuter! [votes: 15]
  • I hate when the frisbee goes over the fence. [votes: 14]
  • When Harry met Not-So-Harry. [votes: 13]
  • The boss is a need'n the 15 bones you owe him. [votes: 12]
  • Your haircut looks really nice, hon. [votes: 10]
  • Jack now regrets being the wingman. [votes: 7]
  • I've heard of bed head, but this must be kennel head! [votes: 7]
  • Give me your coat. [votes: 5]
  • Look what I dug up. [votes: 5]
  • Eskimo Jack visiting the lower 48. [votes: 4]
  • Would you look at that.. [votes: 4]

Results from Contest # 245 [November 11, 2007 - 267 entries]

Contest #245 1st place You're not as big as I think I am. [votes: 48]  parker
2nd place Fox Hunt on Saturday? Count me in! [votes: 38]  Divot
3rd place You gotta win tomorrow, I bet all my biscuits. [votes: 34]  luanne
Honorable Mentions
  • "... and then I struck this pose, and won the show." [votes: 24]
  • I'll get the gate, you take the blame, got it? Good. [votes: 21]
  • Listen horse, big is all in the attitude! [votes: 21]
  • If you are 50% white and can stand like this, I can get you in. [votes: 16]
  • I'm Wilber, what your name? [votes: 15]
  • The Horse Whisperer. [votes: 15]
  • I thought I was the long legged, 50% white, smooth coat. [votes: 14]
  • ... and there was this one time at band camp. [votes: 14]
  • "Are you my mother?" "Neigh." [votes: 10]
  • That's a mighty fine crate you have! [votes: 9]
  • Lookin' for love in all the wrong places. [votes: 9]
  • You must be an over! [votes: 7]
  • I'm going to give you one more chance to tell the truth. Then it's going to get ugly. [votes: 7]
  • One neighsayer didn't know Jack! [votes: 7]
  • Howdy partner! [votes: 6]
  • You had me at hello! [votes: 4]
  • Yeah, I'm betting on you in the Derby. [votes: 3]
  • How's the weather up there? [votes: 3]
  • Are you thinking what I'm thinking? [votes: 1]

Results from Contest # 244 [November 4, 2007 - 203 entries]

Contest #244 1st place Jacky plans his getaway from obedience class.  Becky
2nd place Tour De Jack. [votes: 37]  Gerry Hazelton
3rd place This agility training is just getting out of hand! [votes: 35]  Matt Haring
Honorable Mentions
  • I never thought I'd be thanking God for being NEUTERED! [votes: 28]
  • Must... catch... mailman! [votes: 25]
  • Who put this junk on my beautiful dirt?? [votes: 20]
  • This doesn't feel right. And I look stupid. [votes: 19]
  • Too bad I chewed all the rubber of the tires, this would have been fun to ride. [votes: 15]
  • Whadaya mean it's a lawn ornament? [votes: 14]
  • Easy Rider. [votes: 14]
  • Let them heel -- I'm gonna WHEEL! [votes: 13]
  • Two tires, and a splash of gas - Daytona "2008" here I come!!! [votes: 11]
  • ooouch!! Aren't these things suppose to have seats?? [votes: 10]
  • What do you mean they're still not looking? [votes: 10]
  • Jack realized in horror that his bike may have been a rip off! [votes: 10]
  • Gotta get away from all these shelties. [votes: 9]
  • WHAT! no horn on it? [votes: 6]
  • If I wanted to go in circles, I would have just chased my tail. [votes: 6]
  • I run faster than I pedal... [votes: 5]
  • Hey, this isn't my bike, mine moves. [votes: 5]
  • Wow! I'm jealous it's 100% white. [votes: 4]
  • Jack be nimble. [votes: 3]
  • oops - I think I've split my difference! [votes: 3]
  • Wheel meet again. [votes: 2]
  • Jack's stationary bike. [votes: 1]

Results from Contest # 243 [October 28, 2007 - 267 entries]

Contest #243 1st place If you think I am dirty, you should see the cat I'm standing on. [votes: 77]  Bill He
2nd place The next thing you know 'ol Jack's a millionaire... [votes: 56]  Clampett
3rd place I think I found your problem, lady. [votes: 50]  Steve T
Honorable Mentions
  • I guess sleeping in the bed is out of the question. [votes: 31]
  • What do you mean I need a bath? [votes: 29]
  • Life is good. [votes: 21]
  • Come on in; the water's fine! [votes: 16]
  • Muddy Buddy. [votes: 16]
  • Heaven!! [votes: 15]
  • It puts the lotion on the skin! Or it gets the hose again! [votes: 15]
  • Got Mud! [votes: 15]
  • Jack fell down a well....but saw no reason to get out! [votes: 9]
  • I think I went too far to ground. [votes: 8]
  • I'm still 51% white. [votes: 7]
  • Sometimes it's just too challenging to clean up after your dog. [votes: 6]
  • I'm 17% white! [votes: 5]
  • Going to Ground should be cancelled during the rainy season! [votes: 4]
  • I hope this is mud! [votes: 3]
  • I'm meeelting!! I'm meeelting!! [votes: 2]
  • I'm dirty and plan to stay this way. [votes: 2]

Results from Contest # 242 [October 14, 2007 - 337 entries]

Contest #242 1st place I'm here to spay and neuter the cats... [votes: 38]  Beverly
2nd place McDreamy's got nuthin' on me! [votes: 35]  Divot
3rd place I have a son, and another son, and another son, and a daughter, and another daughter. [votes: 30]  Vic
Honorable Mentions
  • I'm gonna love performing THIS cat scan!!!! [votes: 29]
  • Jack's Anatomy. [votes: 20]
  • I delivered 8 litters today... [votes: 19]
  • First lick the wound clean, then roll in the dirt. [votes: 19]
  • You won't think this is so funny when you see what I did to your shoes... [votes: 19]
  • Mr. Vet...the Jack will see you now...hehehe. [votes: 17]
  • Lunch Lady Jack. [votes: 15]
  • I need a toy, stat! [votes: 12]
  • Smooth operator. [votes: 11]
  • Jack prepares for his second job a Wal-Mart deli attendant. [votes: 10]
  • Just one of the HMO doctors. [votes: 10]
  • Wow...what happened last night? [votes: 7]
  • Jack had to hide the fact that he was a rough coat, but only around the ears. [votes: 6]
  • Beauty school drop out... go back to high school... [votes: 5]
  • My turn!!! Where's that thermometer? [votes: 5]
  • But you don't understand; I like getting my hair wet! [votes: 3]
  • Don't tell the judge that I had my ears done. [votes: 2]

Results from Contest # 241 [October 7, 2007 - 263 entries]

Contest #241 1st place And the ball went in here? ... and it's orange? [votes: 96]  Bobby and DJ
2nd place Jack-o-lanterns. [votes: 68]  raegan
3rd place Please don't lift Jack's by their stem. [votes: 60]  Jolee
Honorable Mentions
  • I swear, he's in here somewhere! He had a big, toothy grin, and yellow shining eyes. [votes: 41]
  • A couple of jacks out of their gourds... [votes: 36]
  • Did you see something move? I saw something move!! [votes: 33]
  • What's a pumpkin? I don't know, but there's got to be one in here somewhere. [votes: 29]
  • The best ones are always at the bottom. [votes: 25]
  • Seriously dude, it was smiling at me! [votes: 25]
  • I'm tellin' ya Charley, one of 'em has to have a face. [votes: 22]
  • ... and that's mine, and that's mine, and that's mine. [votes: 22]
  • The Headless Jacks ride again every Halloween! [votes: 22]
  • Pumpkin, Pumpkin, Pumpkin, Pumpkin, Pumpkin, Gourd, no wait! Pumpkin! [votes: 19]
  • Dig man Dig!!! [votes: 18]
  • Jack and Jill realized with horror that they may just be in the wrong nursery rhyme. [votes: 15]
  • Dumpster Diving! [votes: 11]
  • The end of the pumpkin patch. [votes: 8]
  • Just can't wait for pumpkin pie! [votes: 3]
  • Sometimes ya gotta take the rough with the smooth during the harvest. [votes: 2]
  • Pumpkin head, pumpkin head! [votes: 1]

Results from Contest # 240 [September 30, 2007 - 256 entries]

Contest #240 1st place Slumber Jack. [votes: 78]  Jolee
2nd place Don't wake me unless you have a confirmed squirrel sighting. [votes: 50]  Anne Wetzork
3rd place Sleeping like a log. [votes: 38]  Regie Simmons
Honorable Mentions
  • Lumber Jack. [votes: 32]
  • Ssshhh! Be wery, wery quiet...we're hunting wabbits! [votes: 23]
  • Bark-o-lounger [votes: 21]
  • Jack rested contently, knowing the squirrels had nowhere else to hide. [votes: 20]
  • Wanna know my sleep number? [votes: 18]
  • I get more work done by 5am then most dogs get done all day. [votes: 18]
  • I'm a lumber Jack and I'm OK... [votes: 17]
  • This is not my definition of a "working" terrier! [votes: 15]
  • I'm just resting my eyes. [votes: 14]
  • Just another bump on a log. [votes: 11]
  • Power Nap. [votes: 8]
  • Jack was kicked out of drama class for being too wooden. [votes: 6]
  • Jack laid there with a splitting headache. [votes: 6]
  • My bark is bigger than my bite. [votes: 4]
  • All Work And No Play. [votes: 2]

Results from Contest # 239 [September 23, 2007 - 205 entries]

Contest #239 1st place Another ugly shirt gift from Grandma. [votes: 29]  Belle
2nd place - tie Does this shirt go with my tongue? [votes: 28]  hmpstd
2nd place - tie Clive often wondered why he was labeled a "nerd". [votes: 28]  Scott Beasley
Honorable Mentions
  • Watch out I can't control my licker! [votes: 21]
  • Eat your heart out Gene. [votes: 20]
  • Jack on Casual Friday. [votes: 18]
  • They call me Sponge Bob No Pants! [votes: 18]
  • Prep school dropout. [votes: 17]
  • Any trace of the cat on here? [votes: 16]
  • I make this shirt look good! [votes: 16]
  • Look me in the eye, no, the other eye. Oh forget it! Just look at my tongue! [votes: 15]
  • Why would you do this to someone you love?! [votes: 14]
  • This is what I think of red trim on a light blue shirt. [votes: 11]
  • If I could just.. get.. the top button... [votes: 11]
  • Stamp licking Jack. [votes: 10]
  • Ahhh, I'll never get a date with grandpa dressing me! [votes: 10]
  • OK, I'll wear your shirt if you will let me pee on your leg. [votes: 6]
  • Poor Jack. He was always picked last for GTG. [votes: 5]
  • I only LOOK innocent. [votes: 4]

Results from Contest # 238 [September 16, 2007 - 253 entries]

Contest #238 1st place What happens at the boarding kennel, stays at the boarding kennel. [votes: 86]  Linda
2nd place If lovin' you is wrong, I don't wanna be right. [votes: 47]  scout
3rd place Little ditty bout Jack and Diane. [votes: 25]  Tony
Honorable Mentions
  • Cat Log Day 3: New cell mate still jumpy. Can't shake feeling she's planning on eating me. [votes: 23]
  • Reminder to self: NEVER listen to the cat! [votes: 22]
  • Misery loves company. [votes: 15]
  • It's bad enough to be arrested, but to put in with a cat... [votes: 15]
  • Prison Buddy. [votes: 10]
  • Prisoners of Love. [votes: 10]
  • He ain't heavy...he's my brother. [votes: 10]
  • Well at least Jack got to take his pillow with him to Jail. [votes: 9]
  • Behind enemy lines. [votes: 7]
  • I've got friends in low places. [votes: 7]
  • Opposites attract. [votes: 7]
  • Cat nip [votes: 5]
  • Jack's first chew toy that made real sense! [votes: 5]
  • Desperate times call for desperate measures. [votes: 4]
  • Some Things Happen Once In A Lifetime... [votes: 4]
  • Only the Lonely [votes: 4]
  • Where is that bail Bondsman? [votes: 4]
  • Cats got your tongue? [votes: 4]
  • Midnight Snack. [votes: 3]
  • If you can't do the time, don't do the crime. [votes: 3]
  • Here today....gone tomorow! [votes: 3]
  • One of these had better be stuffed! [votes: 2]

Results from Contest # 237 [September 9, 2007 - 201 entries]

Contest #237 1st place Now thats marking your territory!!! [votes: 70]  David Hale
2nd place Distance was only one of the reasons the entire pack looked up to spike. [votes: 40]  Jim P
3rd place Jacks compete for accuracy, Great Danes compete for distance.  Vicki
Honorable Mentions
  • Wow, Sparky had to go REAL bad! [votes: 22]
  • Uh, that's not a fountain bro. [votes: 22]
  • The tree! The tree! You're suppose to hit the tree! [votes: 22]
  • OK, I'm impressed. [votes: 17]
  • You go first....No you go first... [votes: 16]
  • That better be hose water! [votes: 15]
  • Hey dont lick that..I don't think it's a fountain. [votes: 10]
  • Cool trick, Bobby, but you ain't gettin' us to chase it! [votes: 6]
  • Guys remember never cross the stream or else... [votes: 6]
  • I wanna know where that water is coming from. [votes: 6]
  • Are WEEEEE having fun yet? [votes: 4]
  • Suddenly fire hydrants didn't seem so important now... [votes: 3]
  • Where's the lifeguard? [votes: 3]
  • Have no fear the pool cleaners are here! [votes: 3]
  • He missed again! [votes: 2]

Results from Contest # 236 [September 2, 2007 - 357 entries]

Contest #236 1st place Russell Rescue [votes: 67]  Cheryl
2nd place COWABUNGA DUDE!! [votes: 42]  Sindy
3rd place I'm.. too sexy for my vest.. too sexy for my board. [votes: 28]  Thom
Honorable Mentions
  • wait for it.......wait for it...... [votes: 26]
  • Oh No, that's not the "Jaws" music, is it? [votes: 24]
  • Oooooh....Everbody's gone surfin... JRTCA! [votes: 23]
  • Bark Watch. [votes: 20]
  • 2007 JRTCA National Aquatic agility trials [votes: 18]
  • Here I come to save the day!!!! [votes: 18]
  • And we will have fun, fun ,fun, till our daddy takes our steak bones away! [votes: 13]
  • This thong is killing me! [votes: 12]
  • My mom dressed me like this. [votes: 11]
  • Watch me "Hang eight". [votes: 11]
  • A Three Hour Tour, A Three Hour Tour. [votes: 10]
  • I make these look good. [votes: 7]
  • I'm so cool, I can't even take it. [votes: 7]
  • Jack's endless summer. [votes: 7]
  • Waitin' for the big one! [votes: 5]
  • Jack be nimble, Jack be Slick, Jack hurry to my boat real quick! [votes: 5]
  • Jack couldn't bring himself to be saved by a CAT-amaran! [votes: 4]
  • Next time, with truth or dare, I'll choose truth!!! [votes: 4]
  • OK, you win.......come back! [votes: 4]
  • California dreamin. [votes: 3]

Results from Contest # 235 [August 26, 2007 - 216 entries]

Contest #235 1st place When did these chew bones come with a hairball attached? [votes: 48]  EBT
2nd place I might look small, but it's MINE. [votes: 44]  kd
3rd place Jack the Gripper [votes: 42]  Pat
Honorable Mentions
  • Your huge paws are no match for my attitude...I suggest you let go!! [votes: 36]
  • Chewin' with the BIG dogs! [votes: 34]
  • I promise I'll bring it right back. [votes: 22]
  • I got my money on the Jack... [votes: 19]
  • Size doesn't matter! [votes: 18]
  • Brains vs. Brawn. [votes: 18]
  • No retreat....no surrender!! [votes: 17]
  • Let me help you chew on that. [votes: 16]
  • Now If the dog on the Right was bigger, It'd be a Fair fight! [votes: 15]
  • bone heads... [votes: 14]
  • The mailman didn't have a chance. [votes: 14]
  • Beauty and the Beast. [votes: 12]
  • I see you're on your last tooth, this will be easy... [votes: 12]
  • Courage is... [votes: 10]
  • ShareHOLDER [votes: 8]
  • No Fear... [votes: 8]
  • And I have the results of the paternity tests...right here! [votes: 8]
  • I love flirting with danger. [votes: 7]
  • Look who Jack brought home! [votes: 5]
  • Let's meet in the middle! [votes: 4]

Results from Contest # 234 [August 19, 2007 - 339 entries]

Contest #234 I .... want .... OUTTTTTTTTTTTT!!! [votes: 77]  Julz
OOOOAKlahoma where the wind ... [votes: 53]  Nora
Brother for sale, cheap! [votes: 35]  jack's girls
Honorable Mentions
  • That's IT!! One more Jack in the Box comment and I'm sicking my little brothers on your ankles! [votes: 34]
  • HEY Meester, want to buy my seester? [votes: 29]
  • I'm obnoxious, pick me! [votes: 29]
  • If someone doesn't play with me soon, I'm gonna scream even louder!!! [votes: 21]
  • See, still have all my puppy teeth; I am completely harmless to your furniture. [votes: 21]
  • LEG CRAMP!!!!!!!!!!!!!! [votes: 21]
  • Hey Ump, you stink! [votes: 20]
  • Shout! Shout! Let us all out! [votes: 12]
  • I want fries with that, please! [votes: 9]
  • And stay out!!! [votes: 8]
  • I always get stuck with singing the lead in all our road shows. [votes: 6]
  • help !! i'm trapped with nonconforming jacks !! [votes: 3]
  • Time to make the biscuits! [votes: 2]
  • Hey does anyone have any a mint??? [votes: 1]

Results from Contest # 233 [August 12, 2007 - 189 entries]

Contest #233 OK, the leak is at the PVC coupling. Hand me a new one, will ya? [votes: 36]  Sniggy
Yikes, my roots are showing! [votes: 31]  Vessey
I love the smell of gopher in the morning... [votes: 31]  Brenda
Honorable Mentions
  • I don't think I'm in Kansas anymore. [votes: 28]
  • This is the BEST place I've ever made! [votes: 23]
  • Where am I and where are my pants? [votes: 23]
  • MMMMM HOBBIT.......... TASTY! [votes: 22]
  • Dirty dog done dirt cheap! [votes: 21]
  • This hunting stuff makes you very tired. [votes: 18]
  • I'm hiding from my mother-in-law. [votes: 18]
  • Power Nap. [votes: 13]
  • Am I there yet? [votes: 12]
  • Last night I slept like a log....and woke up IN one! [votes: 12]
  • I knew I shouldn't have eaten that last donut. [votes: 11]
  • I can't believe I ate the whole thing. [votes: 9]
  • Was that fun, or what! [votes: 9]
  • Here kitty, kitty. [votes: 8]
  • Sweet dreams are made of this... [votes: 7]
  • HELP! I've fallen and I can't get up. [votes: 4]
  • Luxurious Clay Bath. [votes: 3]
  • Home dirty home. [votes: 3]

Results from Contest # 232 [August 5, 2007 - 278 entries]

Contest #232 Say hello to my little friend... [votes: 45]  Bailey
I asked for a brother and this is what I got. [votes: 30]  Kat
This is my brother, from another mother. [votes: 27]  George
Honorable Mentions
  • I dare you to take it. [votes: 26]
  • Okay, I took the cute picture, can I eat it now? [votes: 25]
  • Jack liked to take a picture of his victims... [votes: 19]
  • Please play with us. [votes: 17]
  • My friend Sammy I want a cookie. Oh, and he said I could have his. [votes: 17]
  • Pete and Repeat. [votes: 16]
  • Ever notice how toys (like owners) eventually resemble their dogs? [votes: 14]
  • Back away slowly and no one will get hurt. [votes: 10]
  • Me and my shadow. [votes: 8]
  • He ain't heavy... he's my brother. [votes: 7]
  • A latchkey dog's best friend. [votes: 6]
  • If I hold still enough, the cat will never notice until it's too late! [votes: 6]
  • We have only been together for 3 days and the thrill is gone! [votes: 6]
  • And Mom said I was the only child! [votes: 5]
  • You won't be smiling when I'm done with you! [votes: 5]
  • The cat sent my brother to a taxidermist... [votes: 5]
  • Good cop, bad cop. [votes: 3]
  • Like father like son. [votes: 2]
  • Methinks he doth smile too much !!!! [votes: 2]

Results from Contest # 231 [July 29, 2007 - 288 entries]

Contest #231 Beware: puppy smarter than owner. [votes: 56]  Vickie
Proof that MY Jack Russell is smarter than YOUR honor student. [votes: 45]  Fritter's Mom
A baby gate??? That's all you got??? You don't got Jack! [votes: 44]  Bailey
Honorable Mentions
  • Everybody Limbo!!! [votes: 28]
  • UNDERdog' [votes: 25]
  • No one keeps baby in a cage! [votes: 25]
  • It might be a baby gate but it ain't a puppy gate! [votes: 24]
  • The Great Escape. [votes: 24]
  • Jack be nimble....Jack be quick. [votes: 22]
  • One down. Next up lasers and trip wires. [votes: 20]
  • I'm busting out of this place, I can't do the time! [votes: 17]
  • Does this gate make my butt look big? [votes: 15]
  • Problem solved. [votes: 14]
  • Here kitty kitty. [votes: 14]
  • Don't Fence Me In! [votes: 13]
  • I'm gonna pretend I can't get out so my humans won't feel bad--they're so clueless sometimes. [votes: 11]
  • I should of dug a little deeper!!!!! [votes: 8]
  • Who let the dogs out? [votes: 5]
  • He worries about his tail clearing seemed unfounded at this point. [votes: 4]
  • Under, ACHIEVER! [votes: 4]
  • Jack's got BACK! [votes: 2]
  • I think I saw this in a movie once. [votes: 2]

Results from Contest # 230 [July 22, 2007 - 213 entries]

Contest #230 Psssstttt, we're diggin' out tonight, pass it on. [votes: 46]  Alan Lidbom
They took him to the vet and did WHAT??? [votes: 45]  Nikki26
The REAL Dog Whisperer. [votes: 33]  Divot
Honorable Mentions
  • Stop saying that, I am not adopted! [votes: 31]
  • Stop it, honey! I've got to go to work! [votes: 26]
  • Pst, I double dog dare ya!!! [votes: 19]
  • YIKES! We've been framed! [votes: 16]
  • can you keep a secret? [votes: 15]
  • I drink out of the toilet. [votes: 15]
  • She did what??? [votes: 13]
  • ...this one time, at band camp... [votes: 11]
  • We gotta think outside the box. [votes: 10]
  • I'm not one to gossip, but... [votes: 10]
  • Love at first bite. [votes: 8]
  • And the password is... [votes: 8]
  • A cat walked in to a bar... [votes: 7]
  • Look, It's Harry Potter. He passes our portrait everyday and still no bone! [votes: 7]
  • The Voices Are Telling Me To Jump! [votes: 6]
  • Don't forget to give the judge a "big wet one" right after he checks your teeth! [votes: 6]
  • Don't look, but somebody's taking our picture. [votes: 4]
  • Jack the QUIPPER. [votes: 3]

Results from Contest # 229 [July 15, 2007 - 122 entries]

Contest #229 I'm tellin' ya Jack...these stripes were...not...here an hour ago! [votes: 50]  Brenda
You'll be fine. I've ruined plenty of blinds. [votes: 37]  Clayton
Shhh, It's the mailman! [votes: 34]  Diane
Honorable Mentions
  • Whatever it is...let's kill it! [votes: 34]
  • Hey Pop, did you have to wear a harness when you were little? [votes: 27]
  • Love is blind. [votes: 20]
  • When you see the cat's shadow-it's lunch time. [votes: 20]
  • Stay away from the light. It got Bud back in '99. [votes: 13]
  • So, uh, whatcha in for? [votes: 13]
  • They're Back !!! [votes: 10]
  • I think we're alone now. [votes: 10]
  • How do you make a venetian blind? Poke him in the eyes! [votes: 10]
  • Reckon we're about to be abducted by aliens, hope there's cats there! [votes: 9]
  • The gig is up; remember to blame it on the kid. [votes: 8]
  • You've got the brawn, I've got the brains...let's make lots of money. [votes: 7]
  • What did ya say?? Man, you made me lose count!! [votes: 6]
  • Someday all this will be yours. [votes: 5]

Results from Contest # 228 [July 8, 2007 - 244 entries]

Contest #228 Excuse me - did you say I am NOT going on vacation with you? [votes: 62]  dextersmom
Don't cha wish your jack was HOT like ME !!!! [votes: 44]  Roxy
'Jack' Nicholson. [votes: 37]  Pat
Honorable Mentions
  • Too cool for obedience school. [votes: 34]
  • What makes you think Nationals went to my head? [votes: 20]
  • My future's so bright, I gotta wear shades. [votes: 17]
  • I make this look good... [votes: 17]
  • Single Jack Male seeking Single Jack Female, vaccinations not important. [votes: 16]
  • Jack of all Shades. [votes: 15]
  • Jack-of-all-SHADES. [votes: 14]
  • No autographs please! [votes: 11]
  • Let's do lunch. I'll have my people get with your people. [votes: 11]
  • I wear my sunglasses at night... [votes: 11]
  • Seeking female: must be house broken, 51% white, nice gait....strays need not apply. [votes: 11]
  • If you ain't got these glasses, you ain't got jack. [votes: 8]
  • Jack makes a spectacle of himself for attention. [votes: 8]
  • You can't handle the truth about the cat! [votes: 6]
  • Jackie Oh! [votes: 4]
  • Don't it make my brown eyes BLUE? [votes: 4]
  • I ain't nothin' but a hound dog. [votes: 4]
  • Don't you get tired of looking at such total PERFECTION? [votes: 3]
  • Let's take it outside... [votes: 2]
  • Objects (cats) seen may appear closer than they seem. [votes: 1]

Results from Contest # 227 [July 1, 2007 - 298 entries]

Contest #227 One of the disadvantages of being a short legged Jack Russell! [votes: 49]  Helen Mason
Get in my belly... [votes: 41]  skip
I think I can, I think I can, I think I can... [votes: 30]  Martha
Honorable Mentions
  • The Spotted Chef !! [votes: 25]
  • No, my instructions clearly specified to put this on the floor... [votes: 24]
  • It's Shake-n-Bake and I helped! [votes: 24]
  • Is this a fat joke? [votes: 22]
  • When will the cat be done? [votes: 20]
  • Can I get a little help here? [votes: 18]
  • Jack the 'Sniffer'. [votes: 16]
  • I'll have mine rare - right now. [votes: 15]
  • Here chicky, chicky, chicky... [votes: 9]
  • Fatal Attraction. [votes: 8]
  • Bacon, bacon, bacon! [votes: 7]
  • I like mine with grey hair and a bushy tail! [votes: 7]
  • Jack realizes that there's a down side to stove top cooking. [votes: 6]
  • 1 For You, 2 For Me. [votes: 5]

Results from Contest # 226 [June 24, 2007 - 224 entries]

Contest #226 Jack be nimble, Jack be quick, Jack passed out on a big ol' brick. [votes: 93]  Hailey Girl
One tequila, two tequila, three tequila, Floor!!  Bobbie Jo
Slumber jack. [votes: 36]  Michelle
Honorable Mentions
  • When you're really tired, any pillow will do. [votes: 30]
  • Jack the Napper. [votes: 19]
  • Did I get a pillow for Christmas? Noooo, another collar! [votes: 19]
  • Jack listened carefully to the brick for hours, yet he still heard nothing. [votes: 19]
  • Dog Tired. [votes: 19]
  • I feel like Paris Hilton in prison. All I did was bite off the end of the cat's tail!! [votes: 16]
  • This is NOT a Holiday Inn Express!!! [votes: 14]
  • My head is on the chopping block again. [votes: 13]
  • Let sleeping dogs lie. [votes: 13]
  • Dog days of summer. [votes: 11]
  • Mom always said there would be days like this. [votes: 11]
  • Jack on Board! [votes: 9]
  • Jack is finally thinking concrete thoughts! [votes: 9]
  • Play Hard, Rest Well! [votes: 7]
  • I should have waited the 30 minutes after eating before swimming! [votes: 6]
  • Union Break. [votes: 5]
  • I am tired of being 51% white. [votes: 5]
  • A chip off the ol' block... [votes: 4]
  • I love the smell of Brick in the Mornin. [votes: 4]
  • Yeah, I'm probably too hot but I don't know it yet. [votes: 3]
  • This is not as comfortable as it may seem. [votes: 2]

Results from Contest # 225 [June 17, 2007 - 279 entries]

Contest #225 Hi, I'm Jack Russell, you must be Jack Daniels. [votes: 59]  Tam
Told you not to bite the lamp cord. [votes: 53]  Herman
Wow buddy, that must have been one great party! [votes: 41]  Thom
Honorable Mentions
  • Stuck your head out at the car wash didn't you? [votes: 38]
  • Yes, it was a skunk... anymore dumb questions???? [votes: 36]
  • You short haired Jacks just roll out of bed and look good. It takes a lot of work for me. [votes: 35]
  • Just don't ask... [votes: 23]
  • If Lindsay Lohan was a Jack Russell. [votes: 22]
  • Chased the ole' black cat with the white stripe did ya. Smell you later! [votes: 12]
  • One eyed Jack. [votes: 10]
  • I'm the favorite. Pass it on. [votes: 9]
  • This secret will make your hair stand on end. [votes: 9]
  • Notice: this jack russell terrier has just woken up. do not disturb. may pee on carpet. [votes: 8]
  • Brylcream... a little dab would do you good. [votes: 8]
  • I know I look and smell bad, but you should see the other guy! [votes: 8]
  • Guess which Jack used the name brand dog shampoo! [votes: 8]
  • Do I HAVE to give Aunty a kiss? [votes: 5]
  • MOM!!! Jack's been into your conditioner again! [votes: 4]
  • Tell me again. How did you sneek out? [votes: 4]
  • Before and After. [votes: 3]
  • Go and clean your room. Now! [votes: 1]
  • Out chasing squirrels again Jack? [votes: 1]

Results from Contest # 224 [June 10, 2007 - 277 entries]

Contest #224 See, I told you the cat was heavier than the muffin. [votes: 98]  Rick and Rox's Mom
This is their sick way of getting us to take a bath. [votes: 60]  branden
The 5-second rule still applies...doesn't it??? [votes: 43]  Bailey
Honorable Mentions
  • If we stare at it long enough, it will come to us... [votes: 33]
  • Her cooking's so bad I was sure it would sink! [votes: 21]
  • It's not worth it, Joe ... there' a plate full of 'em on the table! [votes: 21]
  • Do You Know The Muffin Man?? [votes: 18]
  • Damn Cinnabons. Somebody's gettin' wet. [votes: 18]
  • Double The Pleasure, Double the Fun. [votes: 17]
  • Did it move? I think it moved, yep, it moved! [votes: 15]
  • Is it worth it? [votes: 12]
  • I feel sorry for the cat, but he let go of the muffin. [votes: 10]
  • The silence of the Jacks... [votes: 10]
  • Top o' the muffin to ya! [votes: 8]
  • Trick Or Treat? [votes: 5]
  • Going, going scone! [votes: 5]
  • Everyone outta the pool. [votes: 3]
  • You know Mom's just inside the door with a camera, right? [votes: 3]

Results from Contest # 223 [June 3, 2007 - 373 entries]

Contest #223 You think you're going without ME--you don't know JACK!! [votes: 77]  Linda
You are not leaving me with Grandma, again! [votes: 69]  Tammy
What happens at Nationals...Stays at Nationals... [votes: 30]  SpitFyre
Honorable Mentions
  • Hit the Road Jack...! [votes: 24]
  • How to get your JRT X-Rayed for free! [votes: 22]
  • No Jack Left Behind! [votes: 20]
  • Are we there yet??? [votes: 20]
  • All my bags are Jacked...I'm ready to go... [votes: 19]
  • I'm going to DISNEY WORLD!!! [votes: 16]
  • Jack Pack [votes: 15]
  • Some day my mom will buy me a travel crate. [votes: 14]
  • Jack the Tripper! [votes: 14]
  • What the?? Hmm, last thing I remember is closing my eyes, then a zipping sound... [votes: 14]
  • Have Jack, will travel. [votes: 11]
  • We all come with our own baggage! [votes: 10]
  • The best traveling companion anyone can have. [votes: 9]
  • Do you think they will serve peanuts on this flight? [votes: 6]
  • Will I fit in the overhead bin? [votes: 6]
  • Homeward Bound [votes: 6]
  • Curses foiled again. [votes: 6]
  • Hopefully my people remember to check this as a carry on this time. [votes: 5]
  • I hate flying coach... [votes: 4]
  • I've always wanted to see France. [votes: 3]
  • Time to pack for the next terrier trial. [votes: 3]
  • How much extra for carry-on ticket? [votes: 1]

Results from Contest # 222 [May 27, 2007 - 304 entries]

Contest #222 How many Jacks does it take to flood the bathroom? [votes: 57]  Charlotte
Do we want "C"ookies or "H"amburger? [votes: 53]  Barb Eales
If I can reach that razor, we'll shave that cat while he sleeps! [votes: 52]  sam's dad
Honorable Mentions
  • I've seen them... they stand here and the indoor rain comes. [votes: 49]
  • JACK-CUZZI. [votes: 49]
  • Trust me. I know what I'm doing. [votes: 42]
  • It was horrible! NEVER turn this lever to the right. [votes: 39]
  • Curiosity Cleaned the Jack. [votes: 32]
  • I double dog dare you! [votes: 22]
  • Who needs a groomer, we can do this ourself. [votes: 14]
  • Hey I wonder what this does? [votes: 11]
  • You got the stopper in? How long do you think it will take to fill the room up? [votes: 7]
  • If you start singing, I'm outta here. [votes: 6]
  • Darn! Still too short to reach the faucet! [votes: 6]
  • Gonna wash that Jack right outta my hair! [votes: 5]
  • Group shower, I saw this once in a late night movie! [votes: 5]
  • No shower for me thanks, I have conformation next week! [votes: 1]

Results from Contest # 221 [May 20, 2007 - 267 entries]

Contest #221 Are you sure this is a baby tooth? [votes: 45]  Daniel
Jack's reinactment of "Lady and the Tramp" was not going as planned... [votes: 38]  Erin
No, I'M taking YOU for a walk. [votes: 38]  Arthur
Honorable Mentions
  • Everybody LIMBO! [votes: 32]
  • Jack and Jill devise a plan to tie up the cat. [votes: 31]
  • mine mine mine mine [votes: 29]
  • You said "no strings attached"! [votes: 24]
  • Oh Yeah! That's got it. Thanks man, that piece of cat has been stuck in there for days! [votes: 22]
  • Hey, we agreed what mine is mine and what yours is mine. [votes: 19]
  • This is BORING, let's go find a squirrel. [votes: 17]
  • I'm really at the end of my rope dear. [votes: 13]
  • Time out! I'm caught on something... [votes: 10]
  • oops..I think I swallowed it! [votes: 7]
  • This looked better in the movie. [votes: 7]
  • It's going to be a long night. [votes: 6]
  • Field day at obedience school. [votes: 6]
  • Mom went on a vacation, and all she brought back was this rope...burp...with a cat attached. [votes: 5]
  • Sure would be nice to have thumbs eh? [votes: 4]

Results from Contest # 220 [May 13, 2007 - 211 entries]

Contest #220 Spot, Spot, Spot and their other brother, SpotLESS. [votes: 64]  Pat
We give this food two tails up. [votes: 55]  hwood
You idiot! That glue didn't make us "super!" [votes: 54]  Daniel
Honorable Mentions
  • X marks the Spot!! [votes: 28]
  • We're losing him doctor! [votes: 25]
  • I know we can do it if we put our heads together! [votes: 24]
  • Hey guys, last one to finish is a cat lover! [votes: 24]
  • JRT Pinwheel Dinner - Eat clockwise. [votes: 17]
  • A Meeting of the Minds. [votes: 16]
  • Home cookin'! They'll never recall this!!! [votes: 16]
  • You realize 6 months from now, we won't be able to do this... [votes: 13]
  • You two get the arms. We got the legs. [votes: 9]
  • Stop! Stop! My spots are in there! [votes: 9]
  • Last one to eat loses his spots! [votes: 5]
  • Only surgery could separate them, or the well placed cat. [votes: 4]
  • What's for dinner? [votes: 4]

Results from Contest # 219 [May 6, 2007 - 348 entries]

Contest #219 You lied in your on-line profile.. didn't you? [votes: 51]  Jack 1
Yes, I ordered my steak rare, but I didn't expect this! [votes: 38]  Megan R
To tip, or not to tip, that is the question. [votes: 32]  swtmdmboo
Honorable Mentions
  • This pasture isn't big enough for the two of us. [votes: 32]
  • Less than 50% white...you may be excused from the ring. [votes: 31]
  • You're the biggest broken coat I've ever seen! [votes: 30]
  • ..I said shooo!!, beat it!!........this is my turf steak boy!! [votes: 26]
  • My milk shake brings all the jacks to the yard... [votes: 24]
  • Whoa, what did I just step in? [votes: 20]
  • Get in my belly! [votes: 18]
  • Ima gonna chase ya', then ima gonna eat ya'! [votes: 17]
  • So much cow... so little time [votes: 15]
  • And this one time in obedience camp... [votes: 14]
  • Wow mom went all out with dinner!! [votes: 8]
  • Didn't we have this same conversation yesterday? [votes: 8]
  • Go on .. keep off the grass! [votes: 6]
  • He ain't heavy, he's my brother! [votes: 5]
  • Jack had to confess that he was lactose intolerant [votes: 5]
  • Somebody bring me a pail... [votes: 4]
  • That's it! I want a pay raise! [votes: 2]

Results from Contest # 218 [April 29, 2007 - 415 entries]

Contest #218 I don't know why they call 'em blinds, I can see right through them. [votes: 66]  Bailey
OK the fly is dead. [votes: 49]  Lori Wells
How much is that doggie in the window? [votes: 38]  Pat
Honorable Mentions
  • Heeeree's Johnny! [votes: 37]
  • I hate to interrupt, but this is important... [votes: 33]
  • OOPS, wrong basement. [votes: 26]
  • Dang, this looks easy when the cat does it! [votes: 17]
  • Love is blinds. [votes: 16]
  • No thanks, sorry, I'm just window shopping. [votes: 13]
  • Heh, the neighbor's cat doesn't want to play anymore. He just lays there... [votes: 13]
  • Lets just say this is the result a long night and 1 too many doggy biscuits. [votes: 12]
  • Avon Calling! [votes: 11]
  • I knew this was a bad idea. [votes: 11]
  • You know for a few pennies more, an elizabethan collar would work. [votes: 10]
  • I think Mom is going to be very mad at me. [votes: 10]
  • The doggie door was in use. [votes: 10]
  • Blinded by his own curosity, Jack just had to peek! [votes: 10]
  • Oh ya....I'm watchin you.... [votes: 9]
  • I know what you did last summer. [votes: 9]
  • Today is so not my day! [votes: 9]
  • Heh, why are you sitting on my porcelain water bowl? [votes: 8]
  • What a beautiful mess i made. [votes: 7]
  • Who put this shade in my doggy door? [votes: 7]
  • Wait a minute....am I coming or am I going? [votes: 2]

Results from Contest # 217 [April 22, 2007 - 285 entries]

Contest #217 Jumpin Jack Splash. [votes: 74]  Christa
Dang! I hate it when they hook it up to the air hose. [votes: 67]  Shelby GT
I'm Ready!!!!! Hit the switch... [votes: 34]  Donna4Jacks
Honorable Mentions
  • Hose your daddy? [votes: 26]
  • Hit the remote, I'm on pause! [votes: 24]
  • You've watered your last lawn... [votes: 23]
  • Die alien, die. [votes: 21]
  • Ha HA!!! You will NEVER Bathe me!!! [votes: 19]
  • You mark my territory, and I'll mark yours! [votes: 18]
  • Jack be nimble, Jack be quick. [votes: 15]
  • Yeow!!! Cold water! [votes: 15]
  • Man, this one's gonna hurt... [votes: 13]
  • Uh oh...no water! [votes: 11]
  • What does a guy have to do to get a drink around here? [votes: 9]
  • Jack was very confused by the invisible water. [votes: 9]
  • This landing looks like it might be painful - Houston we have a problem! [votes: 8]
  • Leap of faith. [votes: 6]
  • Don't leave me hanging in a situation like this! [votes: 5]
  • Waiting for the geyser. [votes: 4]
  • Matrix. [votes: 4]
  • What a fun way to get a bath! [votes: 3]
  • Watering, SPOT! [votes: 1]

Results from Contest # 216 [April 15, 2007 - 358 entries]

Contest #216 1st place Somebody moved my doggy door...not funny. [votes: 75]  anonymous
2nd place Who says white dogs can't jump? [votes: 64]  RileyBean
3rd place Gotta go, gotta go, gotta go right now. [votes: 41]  Nancy
Honorable Mentions
  • Jump up, bark at the mailman. Jump up, bark at the mailman. Jump up, bark at the mailman. [votes: 37]
  • Jumpin' Jack! [votes: 25]
  • Don't leave meee!!! [votes: 24]
  • Mom's home!! [votes: 23]
  • I can't see jack out of this little window. [votes: 19]
  • The Mail Man is Here! The Mail Man is Here! [votes: 17]
  • Mom, come quick, there's a man with a big cardboard check outside. [votes: 17]
  • Pizza's here! [votes: 14]
  • Has anyone let the dog out this morning? [votes: 11]
  • It's Dominos, open the door. [votes: 9]
  • Can I see some ID, please? [votes: 9]
  • yoo hoo, Mr. Postman... [votes: 8]
  • What's the password? [votes: 8]
  • She's here! Everybody hide! [votes: 8]
  • Wash on delicate, hang to dry. [votes: 8]
  • Jack be nimble... [votes: 7]
  • Bark, Who goes there??? [votes: 6]
  • There's a girl scout at our door!....order more cookies!! [votes: 5]
  • Heeeeere's Johnny! [votes: 4]
  • Mom told me not to let stangers in while she was gone. [votes: 1]

Results from Contest # 215 [April 8, 2007 - 276 entries]

Contest #215 If anybody asks, we did NOT do it, we were taking naps.... [votes: 67]  Dusty's Mom
Come on!! You run like a Cat! [votes: 58]  Mercedes
If you can't keep up with the little white dogs, stay on the porch!  Divot
Honorable Mentions
  • Run Forrest! Run!!! [votes: 39]
  • I think I stepped in something. [votes: 27]
  • You put your left leg in.. you put your left leg out... [votes: 26]
  • Jacks new jogging partner is a little rusty... [votes: 26]
  • Dude! Mom's gonna kill you when she see's how muddy you got! [votes: 21]
  • Don't touch me with those muddy paws--I'm wearing WHITE! [votes: 21]
  • And then she said I was insensitive! Do you think I'm insensitive? [votes: 21]
  • Anything you can do I can do better! [votes: 18]
  • You got any last requests before you eat my dust? [votes: 17]
  • JRT trials are second on the left, straight ahead for 1 mile. [votes: 14]
  • Thelma and Louise. [votes: 10]
  • Take a look at my girl friend, she's the only one I got. [votes: 10]
  • When we get home, you wanna rip that perfectly good toy that mom bought us yesterday up? [votes: 9]
  • Run, run, now feel the burn! [votes: 8]
  • Happy Feet. [votes: 6]
  • Lets Do Some Hunting! [votes: 4]
  • Who let the dogs out? [votes: 4]

Results from Contest # 214 [April 1, 2007 - 306 entries]

Contest #214 First I'm gonna de-squeak ya, then I'm gonna eat ya. [votes: 74]  Bailey
Who's Your Daddy? SAY IT !!!! SAY IT !!!! [votes: 35]  Roxy
Beef...It's what's for dinner... [votes: 35]  SpitFyre
Honorable Mentions
  • Don't you udder another word! [votes: 28]
  • All toys must die. [votes: 27]
  • My Precious!! [votes: 24]
  • Mad Cow, Mad Cow! [votes: 22]
  • Now I have you, you cow-ard! [votes: 21]
  • Resistance is futile. [votes: 17]
  • Jack is lactose intolerant. [votes: 16]
  • Snap plastic leg (part A) into body (part B) and your new cow toy is ready for hours of enjoyment! [votes: 14]
  • Where's the beef? [votes: 13]
  • Any last words? [votes: 12]
  • Die before I kill you. [votes: 12]
  • Just wait 'till they fire up the grill. [votes: 9]
  • Do you know the muffin man? [votes: 7]
  • Hey...this one's out of milk!! [votes: 6]
  • Any last requests? A blindfold, maybe? [votes: 5]
  • The cow was mislead on how the milking was done. [votes: 4]
  • Who's the dummy now? [votes: 4]
  • What a non creative caption! [votes: 1]

Results from Contest # 213 [March 25, 2007 - 248 entries]

Contest #213 That St. Bernard next door must be getting another bath. [votes: 46]  Dillon
Jack contemplates how he will attack each and every one... [votes: 41]  Julz
So many bubbles so little time. [votes: 40]  Carol
Honorable Mentions
  • I don't think the weatherpeople saw this one coming... [votes: 37]
  • If only we could open the door. [votes: 30]
  • Look.....at all those balls. [votes: 27]
  • Sorry kid... bubbles give me gas. [votes: 24]
  • This is way better than snow. [votes: 22]
  • I don't think we're in Kansas anymore, Toto!! [votes: 18]
  • One day my son, all this shall be yours! [votes: 16]
  • Don't worry kid, when you get older I'll teach you how to play with those. [votes: 13]
  • After they clean you with the soap bubbles, they put a diaper on you! [votes: 12]
  • Yeah, I want to go outside too. You share my pain, brother. [votes: 12]
  • Cheap entertainment. [votes: 11]
  • They are so pretty... I wonder what they TASTE like! [votes: 10]
  • The sky is falling, the sky is falling! [votes: 9]
  • How many do you think there are? [votes: 6]
  • Connect the dots. [votes: 5]
  • It's the most beautiful sight I've ever seen! [votes: 5]
  • How many of those do YOU see...? [votes: 4]

Results from Contest # 212 [March 18, 2007 - 321 entries]

Contest #212 A little ditty about Jack and Diane. [votes: 47]  Amy C
Are we there yet? [votes: 44]  KaiserJack
I know she put the groceries back here. [votes: 37]  Jdurbin
Honorable Mentions
  • My Jack is smarter than your honor student! [votes: 35]
  • He ain't different, he's my brother. [votes: 29]
  • You gonna puke? I'm gonna puke. [votes: 27]
  • Say hello to my little friend. [votes: 24]
  • Mutt & Jack. [votes: 22]
  • What are you guys doing in the trunk? [votes: 19]
  • Isn't it fun making faces at the cars behind us? [votes: 19]
  • I told you the cat could run really fast... [votes: 15]
  • Seat Belts ! We don't need no stinkin' seat belts! [votes: 15]
  • Oh-oh...Who's drivin'?! [votes: 12]
  • Whatever it is, we didn't do it!! [votes: 12]
  • Roadtrip! [votes: 11]
  • I think I'm going to be car sick. [votes: 8]
  • Stop tailgating me, man!!! [votes: 6]
  • Are you thinking what I'm thinking? [votes: 6]

Results from Contest # 211 [March 11, 2007 - 321 entries]

Contest #211 Jack and a spare. [votes: 96]  Susan
"Lo-Jacks" - A Vehicle Recovery System. [votes: 62]  Terp's Mom
Those suitcases won't be necessary - just our bowls, thank you. [votes: 34]  swtmdmboo
Honorable Mentions
  • Tire jacks. [votes: 33]
  • Jacks are always good in case of an emergency. [votes: 28]
  • Nope, no junk in this trunk! [votes: 21]
  • Open carefully, contents under pressure. [votes: 20]
  • BABY! I can explain. [votes: 14]
  • Honey, does our auto insurance cover bite marks & car jackings? [votes: 14]
  • Are we there yet? [votes: 13]
  • Spring Break: Jacks gone Wild. [votes: 10]
  • ROAD TRIP [votes: 10]
  • 125 Horsies up front, two doggies in back. [votes: 10]
  • Trunk Drivers. [votes: 10]
  • Yeah, we're bootylicious. [votes: 9]
  • Luggage? There's no room for luggage in here. [votes: 9]
  • We've been very bad... [votes: 7]
  • This sure beats sticking our heads out the window! [votes: 7]
  • Modern-day fox hunting... [votes: 6]
  • I heard the hotel rooms in Europe were small, but geez! [votes: 4]
  • Free at last. [votes: 4]

Results from Contest # 210 [March 4, 2007 - 357 entries]

Contest #210 Lumber jack! [votes: 48]  JJ
Hi, I am a single male Jack who enjoys long walks, good weather and nice trees. [votes: 47]  Paul M
Don't worry. I'll be here when that cat comes down. [votes: 41]  TimT
Honorable Mentions
  • 2007 Sexy JRT Calender [votes: 40]
  • Jack's senior picture. [votes: 28]
  • Sooner or later, it has to come down. [votes: 25]
  • Keep on walking buddy, nothing to see here. [votes: 20]
  • When I stand like this does it make me look fat? [votes: 20]
  • My tree... This is my tree... [votes: 19]
  • Can't a guy get a moment of privacy here? [votes: 17]
  • I like long walks on the leash and a food bowl for two. [votes: 16]
  • You hide and I will seek. [votes: 12]
  • Work it girl! Strike a pose! [votes: 12]
  • What goes up, must come down. [votes: 12]
  • Give me an hour, I'll turn this tree into a beautiful deck. [votes: 11]
  • ...barking up the right tree. [votes: 11]
  • This tree is all bark and no bite!! [votes: 10]
  • So many trees, so little time. [votes: 9]
  • This should get me on the cover of True Grit! [votes: 8]
  • Now this is my kind of urinal! [votes: 7]
  • Sorry, try the next one... this one's occupied. [votes: 5]
  • ah no ... someone been here before! [votes: 1]

Results from Contest # 209 [February 25, 2007 - 333 entries]

Contest #209 5 jacks and a jill. [votes: 59]  swtmdmboo
Dora's Last Exploration. [votes: 53]  Nick Shadursy
You pull her to safety, I'll check her pulse. [votes: 50]  Dianna Gardner
Honorable Mentions
  • CSI: Jack Russell Terrier. [votes: 34]
  • Dora gets explored! [votes: 29]
  • Bad pups, bad pups, whatcha gonna do, whatcha gonna do when they come for you? [votes: 28]
  • I don't like her. She seems fake. [votes: 27]
  • Let's crate 'er! [votes: 26]
  • Dora the Explorer meets Jack the Mauler and his cousins, Vinny, Pete, Frank and Paulo. [votes: 23]
  • How do we know for sure she's not one of the "Others"? [votes: 19]
  • Cabbage Patch Jacks! [votes: 16]
  • Dora is no longer the Explorer. [votes: 16]
  • Tastes like pollo! [votes: 15]
  • Jack the GRIPPER! [votes: 15]
  • Silence of the Dolls. [votes: 14]
  • OH Boy - finally somebody our own size to play with. [votes: 13]
  • Guys and Doll. [votes: 13]
  • She'll never make it in Conformation. [votes: 7]

Results from Contest # 208 [February 18, 2007 - 259 entries]

Contest #208 Punxsutawney Jack. [votes: 111]  Kathy
Be Very Quiet, we're hunting Wabbit! [votes: 60]  Matt Haring
Nope, Not in Florida Yet. Keep digging. [votes: 47]  Donna4Jacks
Honorable Mentions
  • I'm not coming out until you apologize. [votes: 33]
  • The ground hog sleeps with the fishes. [votes: 24]
  • Had to get away from the wife and kids for awhile. [votes: 20]
  • I'm all for Global Warming. [votes: 18]
  • Out last, Out wit, Out play. [votes: 15]
  • Now is the winter of my discontent... [votes: 15]
  • Ah! light at the end of the tunnel! [votes: 14]
  • Occupied. [votes: 12]
  • Baby it's cold outside!! [votes: 11]
  • The weather outside is frightful, but here its so delightful. [votes: 11]
  • How to Housebreak Your Dog in Just One Hour. [votes: 10]
  • Closer Closer just a little closer. [votes: 8]
  • Go to the ground winter edition. [votes: 7]
  • Snow Day! [votes: 6]
  • Prey goes into hole, Jack goes into hole, our JACK, farewell and adieu to the wee little PREY. [votes: 4]

Results from Contest # 207 [February 11, 2007 - 452 entries]

Contest #207 Can you hear me NOW? [votes: 93]  steff
Hey there pussy cat, woahhh woaahhhh wooaahh! [votes: 45]  Rammer
CCCCCCCAAAAAAAATTTTTTTT !!!!!!!!!! [votes: 39]  Helen
Honorable Mentions
  • Get in my belly!! [votes: 32]
  • Ha ha ha ha!!!! Oh, sorry. You're probably tired of the cat jokes. [votes: 28]
  • If you look reaaallly close you can see your brother. [votes: 28]
  • Sometimes I crack myself up. [votes: 20]
  • HOW MANY TIMES do I have to tell you??!!....WIPE...YOUR...PAWS!!! [votes: 19]
  • Dogs rule, cats drool!!! [votes: 17]
  • Does this tooth look infected to you? [votes: 16]
  • You can't handle the truth! [votes: 15]
  • I've heard that you can shatter cats by singing the right note. [votes: 15]
  • It's a no from me, Sorry, you are not going to Hollywood. [votes: 14]
  • I want BACON!!! [votes: 13]
  • I think the cat is ignoring me! [votes: 8]
  • Cat got your tongue? [votes: 8]
  • ...and you play the part of Little Red Ridinghood. [votes: 7]
  • So, Simon, Paula.....what do you think? [votes: 6]
  • It was just a-ight for me dawg. [votes: 5]
  • Make the cat stop. [votes: 3]
  • Pray. My Dear Prey. [votes: 3]

Results from Contest # 206 [February 4, 2007 - 388 entries]

Contest #206 Jack Frost [votes: 98]  Pat
When you said it was knee deep, I thought you meant MY knees! [votes: 48]  Thom Derry
Where am I? This rabbit hole started in Florida. [votes: 46]  Sierra
Honorable Mentions
  • Never thought I'd be glad to be neutered... [votes: 38]
  • SERIOUSLY!!! It's snowing, I'm done going potty. LET ME IN!!!! [votes: 36]
  • I went to ground and came up in Alaska. [votes: 28]
  • Jack-sicle [votes: 28]
  • If I lick my nose, will it stick? [votes: 23]
  • I'm making yellow snow right now. [votes: 22]
  • Chili dog! [votes: 19]
  • Um...could someone call me a St. Bernard? [votes: 17]
  • Ice Ice Baby [votes: 14]
  • Global Warming? What Global Warming? [votes: 13]
  • And they wonder why we are hard to housebreak. [votes: 12]
  • Can you see me now? [votes: 12]
  • Baby it's cold outside. [votes: 9]
  • 6 more weeks of winter??? REALLY???? [votes: 9]
  • I'm thinking Cancun. [votes: 9]
  • Thinking Warm Thoughts !! Thinking Warm Thoughts. [votes: 9]
  • I hope that chicken noodle soup is ready. [votes: 8]
  • Let it snow, let is snow, let it snow. [votes: 7]
  • Hey, we like to dig INTO stuff, not OUT of stuff! [votes: 6]
  • Definitely 51% white. [votes: 6]
  • Al Gore, I'm coming for you!!!! [votes: 5]
  • Periscope Up! [votes: 5]
  • Frigid dare. [votes: 4]
  • Peek...a choo! [votes: 4]
  • Look mom no body. [votes: 4]

Results from Contest # 205 [January 28, 2007 - 359 entries]

Contest #205 Hush little russell don't say a word, Momma's gonna buy you a flying squirrel! [votes: 52]  Roxy
Don't make me turn this stroller around!!! [votes: 43]  Megan Rees
Look at me when I am talking to you. [votes: 37]  Jack
Honorable Mentions
  • Don't make me call your father! [votes: 28]
  • I think somebody needs a "time out". [votes: 26]
  • Are you sure he's mine? [votes: 23]
  • I'm old enough to be on a leash mom! [votes: 22]
  • This isn't mine is it? I want a paternity test. [votes: 20]
  • NO mommy no, I don't wanna go the vet. [votes: 20]
  • Yuk! Mom, you have doggy breath! [votes: 20]
  • Ok...once more around the block - then we go home. [votes: 18]
  • What did you say to me? [votes: 15]
  • Don't you eyeball me boy! [votes: 14]
  • A visit from Nanny 911. [votes: 13]
  • I don't like it either, but Consumer Reports says it's safe. [votes: 11]
  • It wasn't funny yesterday and it's still not funny today! [votes: 10]
  • Don't be a baby, a spit bath never hurt anyone. [votes: 8]
  • Rosemary's Baby. [votes: 7]
  • ... and when they come to claim the seat just growl....with conviction. [votes: 7]
  • Jack shows his nurturing side. [votes: 6]
  • Please... I beg you...do it for your Mother...STOP BARKING!!! [votes: 6]
  • You're suppose to push from the back, Jack!! [votes: 6]
  • How bad do you want to be in the fraternity? [votes: 4]

Results from Contest # 204 [January 21, 2007 - 275 entries]

Contest #204 Lumber Jacks. [votes: 81]  Bailey
When we get to shore, remember "I" found it first! [votes: 48]  Thom Derry
Cold water, a nice stick, my best buddy....LIFE IS GOOD!!! [votes: 46]  Jim Long
Honorable Mentions
  • Let's swim real fast and trip the duck. [votes: 41]
  • This counts as our baths, right??? [votes: 36]
  • We always STICK together! [votes: 28]
  • How did I ever let you talk me into this...i just wanted to chase the squirrels. [votes: 27]
  • United We Swim -- Divided We Sink. [votes: 19]
  • You keep saying dog paddle, dog paddle!!! What do you think I am doing? [votes: 18]
  • I'm tired of filming this stupid Disney movie. [votes: 17]
  • Dog-Paddling. [votes: 16]
  • I can't believe I got the short end of the stick! [votes: 15]
  • We're gonna need a bigger boat. [votes: 12]
  • Are you pulling or pushing? [votes: 12]
  • When the Captain says "Don't touch that" he means it !!!! [votes: 11]
  • Why is this stick so important? [votes: 10]
  • Uh, I don't know about this flotation device, how much further to land? [votes: 6]
  • I'm thinking "Pappillon". [votes: 6]
  • Job competition. [votes: 4]
  • It may not be mud, but we can roll in the dirt afterwards. [votes: 3]
  • Wanna split it...? [votes: 2]
  • Were just going with the flow. [votes: 1]

Results from Contest # 203 [January 14, 2007 - 268 entries]

Contest #203 I still don't understand why they put a DOG BED on my couch. [votes: 111]  Donna4Jacks
Another $39.99 well spent! [votes: 72]  trevor
Bed for sale - very soft - no view. [votes: 35]  JO
Honorable Mentions
  • If it's so comfortable - You sleep in it! [votes: 31]
  • Thinking outside the box. [votes: 29]
  • Always go for the window seat. [votes: 26]
  • Nope, not after the cat slept in it. [votes: 23]
  • How do you expect me to keep an eye on things from down there? [votes: 23]
  • Just in case I fall. [votes: 19]
  • I like livin' on-the-edge! [votes: 17]
  • Snoopy syndrome strikes again. [votes: 14]
  • Anywhere Jack lays his head is his home. [votes: 13]
  • Cat smell, cat smell, jack no sleep in cat smell. [votes: 9]
  • Example of separation anxiety. [votes: 8]
  • Bunk beds. [votes: 7]
  • Another failed idea! [votes: 5]
  • Don't be fooled by imitations. [votes: 5]
  • Sleeping in the loft. [votes: 4]
  • I missed. [votes: 3]
  • I do all my own stunts! [votes: 3]

Results from Contest # 202 [January 7, 2007 - 393 entries]

Contest #202 Russell, Jack Russell. [votes: 126]  Sindy
Every girl's crazy about a sharp dressed jack. [votes: 41]  rebecca91
I'm bringing SEXY back! [votes: 33]  Riley B
Honorable Mentions
  • We meet again, Mr. Bond. [votes: 30]
  • Frankly my dear, I don't give a damn. [votes: 26]
  • I'll take my kibble shaken... not stirred. [votes: 24]
  • I'm too sexy for my shirt. [votes: 23]
  • All dressed up with nothing to chew. [votes: 20]
  • My name is JACK and i will be your waiter tonight. [votes: 20]
  • The difference between me and you is, I make this look GOOD. [votes: 19]
  • Simply irresistible! [votes: 10]
  • I doo, I doo, can I lick the bride? [votes: 8]
  • Did you say sauteed feline? That sounds good, I'll have that! [votes: 8]
  • Jackolicious [votes: 6]
  • I do, I don't, I do, I don't...I can't do this! Wait!! Isn't there going to be cake? I DO!!!! [votes: 6]
  • That was one heck of a party! I think I kissed the cat... [votes: 6]
  • These confirmation awards ceremonies are getting a little to formal... know what I mean? [votes: 6]
  • Where the ladies at? [votes: 5]
  • Got my tie and tails... [votes: 5]
  • One of my better prom dates! [votes: 4]
  • For better or worse, for richer or poorer... [votes: 3]
  • A mischief in disguise. [votes: 3]
  • My bowl is a black tie affair. [votes: 2]
  • By Invitation Only [votes: 1]

Caption Contests Results for 2015, 2014, 2013, 2012, 2011, 2010, 2009, 2008, 2007, 2006, 2005, 2004, 2003